C19orf62-chromosome 19 open reading frame 62 Gene View larger

C19orf62-chromosome 19 open reading frame 62 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf62-chromosome 19 open reading frame 62 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf62-chromosome 19 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000788
Product type: DNA & cDNA
Ncbi symbol: C19orf62
Origin species: Human
Product name: C19orf62-chromosome 19 open reading frame 62 Gene
Size: 2ug
Accessions: BC000788
Gene id: 29086
Gene description: chromosome 19 open reading frame 62
Synonyms: C19orf62; HSPC142; MERIT40; NBA1; BRISC and BRCA1-A complex member 1; BRCA1-A complex subunit MERIT40; mediator of RAP80 interactions and targeting subunit of 40 kDa; mediator of Rap80 interactions and targeting 40 kDa; new component of the BRCA1-A complex; new component of the BRCAA1 A complex; BRISC and BRCA1 A complex member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagtggcagagcccagcagccccactgaagaggaggaggaggaagaggagcactcggcagagcctcggccccgcactcgctccaatcctgaaggggctgaggaccgggcagtaggggcacaggccagcgtgggcagccgcagcgagggtgagggtgaggccgccagtgctgatgatgggagcctcaacacttcaggagccggccctaagtcctggcaggtgcccccgccagcccctgaggtccaaattcggacaccaagggtcaactgtccagagaaagtgattatctgcctggacctgtcagaggaaatgtcactgccaaagctggagtcgttcaacggctccaaaaccaacgccctcaatgtctcccagaagatgattgagatgttcgtgcggacaaaacacaagatcgacaaaagccacgagtttgcactggtggtggtgaacgatgacacggcctggctgtctggcctgacctccgacccccgcgagctctgtagctgcctctatgatctggagacggcctcctgttccaccttcaatctggaaggacttttcagcctcatccagcagaaaactgagcttccggtcacagagaacgtgcagacgattcccccgccatatgtggtccgcaccatccttgtctacagccgtccaccttgccagccccagttctccttgacggagcccatgaagaaaatgttccagtgcccatatttcttctttgacgttgtttacatccacaatggcactgaggagaaggaggaggagatgagttggaaggatatgtttgccttcatgggcagcctggataccaagggtaccagctacaaatatgaggtggcactggctgggccagccctggagttgcacaactgcatggcgaaactgttggcccaccccctgcagcggccttgccagagccatgcttcctacagcctgctggaggaggaggatgaagccattgaggttgaggccactgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 42
- chromosome 19 open reading frame 57
- HemK methyltransferase family member 1
- solute carrier family 25, member 43

Buy C19orf62-chromosome 19 open reading frame 62 Gene now

Add to cart