HEMK1-HemK methyltransferase family member 1 Gene View larger

HEMK1-HemK methyltransferase family member 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEMK1-HemK methyltransferase family member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEMK1-HemK methyltransferase family member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000781
Product type: DNA & cDNA
Ncbi symbol: HEMK1
Origin species: Human
Product name: HEMK1-HemK methyltransferase family member 1 Gene
Size: 2ug
Accessions: BC000781
Gene id: 51409
Gene description: HemK methyltransferase family member 1
Synonyms: HEMK; MTQ1; hemK methyltransferase family member 1; HEMK homolog 7kb; m.HsaHemKP; testis secretory sperm-binding protein Li 225n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctttggggccgaatgctgtgggccctcctgtctggcccagggaggaggggaagtacccggggctgggccttcagctcatggcaaccccaaccacctctggctgggttatccagtgccatagaactggtcagccactggactggggtctttgagaagaggggtatccctgaggcccgggaatccagtgagtacatcgtggctcatgtccttggagccaaaacatttcagagcctgaggccggcactttggacccagcccttgacctctcagcaactacagtgtatccgggagctgagtagccgtcgattgcagaggatgccggtgcagtacatccttggagagtgggacttccaggggctcagcctaaggatggtgcccccagtgtttattccgcggccagaaacagaggaactggttgagtgggtgctggaagaggtggcccagaggtcccatgctgtgggatccccaggcagccccctcattctggaggtgggctgcggatcaggagccatctccctcagcctgctgagccagctcccccagagccgagtcattgctgtggataagcgggaagctgctatctctctgacccatgagaatgctcagaggcttcggttgcaggacaggatttggatcatccacctcgacatgacctcagaaaggagctggacacacctgccctggggccccatggacctgattgtcagcaaccctccctacgtcttccaccaggacatggagcagctggcccctgagatccgcagctatgaagaccccgcggccctggatggtggggaggagggcatggacatcattacccacattctggccttggcaccccggctcctgaaagactctggtagtatcttcttagaagtggacccaaggcacccggagcttgtcagcagctggcttcagagccggcctgacctgtaccttaatcttgtggctgtgcgcagggacttctgtgggaggccccggttcctgcatatccggaggtctgggccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 43
- 3-hydroxybutyrate dehydrogenase, type 1
- chromosome 20 open reading frame 72
- chromosome 16 open reading frame 48

Buy HEMK1-HemK methyltransferase family member 1 Gene now

Add to cart