SLC25A38-solute carrier family 25, member 38 Gene View larger

SLC25A38-solute carrier family 25, member 38 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A38-solute carrier family 25, member 38 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A38-solute carrier family 25, member 38 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013194
Product type: DNA & cDNA
Ncbi symbol: SLC25A38
Origin species: Human
Product name: SLC25A38-solute carrier family 25, member 38 Gene
Size: 2ug
Accessions: BC013194
Gene id: 54977
Gene description: solute carrier family 25, member 38
Synonyms: SIDBA2; solute carrier family 25 member 38; appoptosin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattcagaactcacgtccgtcgctgctgcaaccccaagatgtcggagacacggtggaaacgcttatgttacatccggtgatcaaggctttcctgtgtggctccatcagtgggacctgctctaccctccttttccaacctctggatctccttaaaacacgcctacaaaccctccagccctcagatcatgggtctagacgtgttgggatgttggctgtactcttgaaggtggttcgcacggagagtcttttgggcctttggaaagggatgtccccttccattgtgagatgtgtccctggcgttggaatctactttggcactctctactctttgaagcagtatttcttgcgaggccatcccccaaccgccctggagtcagtcatgctgggggtgggctctcgctctgttgcaggggtctgtatgtcacctatcactgtaatcaagacgcgctatgagagtgggaaatatggctatgagagtatctacgctgccctgaggagcatctatcacagtgaggggcaccggggcctcttcagtggcctgacagcaactctccttcgagatgcgcccttctcaggaatctacctgatgttttacaaccagaccaaaaatatagtgcctcatgaccaggtggatgcaacccttattcctattacaaatttcagctgtgggatatttgctggtattctggcctcactggtaactcaacctgcggatgttatcaaaactcatatgcagctttatccactgaagtttcaatggattggccaagcagtgacacttattttcaaagactatggactacgtggcttcttccaaggtggcatcccccgagccctccgcagaactctaatggcagcaatggcgtggacggtgtatgaagagatgatggccaagatgggcctgaagtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 54
- chromosome 11 open reading frame 65
- inositol 1,3,4-triphosphate 5/6 kinase
- cysteine-rich with EGF-like domains 2

Buy SLC25A38-solute carrier family 25, member 38 Gene now

Add to cart