C10orf54-chromosome 10 open reading frame 54 Gene View larger

C10orf54-chromosome 10 open reading frame 54 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf54-chromosome 10 open reading frame 54 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf54-chromosome 10 open reading frame 54 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020568
Product type: DNA & cDNA
Ncbi symbol: C10orf54
Origin species: Human
Product name: C10orf54-chromosome 10 open reading frame 54 Gene
Size: 2ug
Accessions: BC020568
Gene id: 64115
Gene description: chromosome 10 open reading frame 54
Synonyms: C10orf54; B7-H5; B7H5; DD1alpha; GI24; PD-1H; PP2135; SISP1; VISTA; V-type immunoglobulin domain-containing suppressor of T-cell activation; Death Domain1alpha; PDCD1 homolog; V-domain Ig suppressor of T cell activation; V-set domain-containing immunoregulatory receptor; platelet receptor GI24; sisp-1; stress-induced secreted protein-1; V-set immunoregulatory receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgtccccacggccctggaggccggcagctggcgctggggatccctgctcttcgctctcttcctggctgcgtccctaggtccggtggcagccttcaaggtcgccacgccgtattccctgtatgtctgtcccgaggggcagaacgtcaccctcacctgcaggctcttgggccctgtggacaaagggcacgatgtgaccttctacaagacgtggtaccgcagctcgaggggcgaggtgcagacctgctcagagcgccggcccatccgcaacctcacgttccaggaccttcacctgcaccatggaggccaccaggctgccaacaccagccacgacctggctcagcgccacgggctggagtcggcctccgaccaccatggcaacttctccatcaccatgcgcaacctgaccctgctggatagcggcctctactgctgcctggtggtggagatcaggcaccaccactcggagcacagggtccatggtgccatggagctgcaggtgcagacaggcaaagatgcaccatccaactgtgtggtgtacccatcctcctcccaggagagtgaaaacatcacggctgcagccctggctacgggtgcctgcatcgtaggaatcctctgcctccccctcatcctgctcctggtctacaagcaaaggcaggcagcctccaaccgccgtgcccaggagctggtgcggatggacagcaacattcaagggattgaaaaccccggctttgaagcctcaccacctgcccaggggatacccgaggccaaagtcaggcaccccctgtcctatgtggcccagcggcagccttctgagtctgggcggcatctgctttcggagcccagcacccccctgtctcctccaggccccggagacgtcttcttcccatccctggaccctgtccctgactctccaaactttgaggtcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 65
- inositol 1,3,4-triphosphate 5/6 kinase
- cysteine-rich with EGF-like domains 2
- chromosome 19 open reading frame 62

Buy C10orf54-chromosome 10 open reading frame 54 Gene now

Add to cart