Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf54-chromosome 10 open reading frame 54 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf54-chromosome 10 open reading frame 54 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020568 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf54 |
| Origin species: | Human |
| Product name: | C10orf54-chromosome 10 open reading frame 54 Gene |
| Size: | 2ug |
| Accessions: | BC020568 |
| Gene id: | 64115 |
| Gene description: | chromosome 10 open reading frame 54 |
| Synonyms: | C10orf54; B7-H5; B7H5; DD1alpha; GI24; PD-1H; PP2135; SISP1; VISTA; V-type immunoglobulin domain-containing suppressor of T-cell activation; Death Domain1alpha; PDCD1 homolog; V-domain Ig suppressor of T cell activation; V-set domain-containing immunoregulatory receptor; platelet receptor GI24; sisp-1; stress-induced secreted protein-1; V-set immunoregulatory receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgtccccacggccctggaggccggcagctggcgctggggatccctgctcttcgctctcttcctggctgcgtccctaggtccggtggcagccttcaaggtcgccacgccgtattccctgtatgtctgtcccgaggggcagaacgtcaccctcacctgcaggctcttgggccctgtggacaaagggcacgatgtgaccttctacaagacgtggtaccgcagctcgaggggcgaggtgcagacctgctcagagcgccggcccatccgcaacctcacgttccaggaccttcacctgcaccatggaggccaccaggctgccaacaccagccacgacctggctcagcgccacgggctggagtcggcctccgaccaccatggcaacttctccatcaccatgcgcaacctgaccctgctggatagcggcctctactgctgcctggtggtggagatcaggcaccaccactcggagcacagggtccatggtgccatggagctgcaggtgcagacaggcaaagatgcaccatccaactgtgtggtgtacccatcctcctcccaggagagtgaaaacatcacggctgcagccctggctacgggtgcctgcatcgtaggaatcctctgcctccccctcatcctgctcctggtctacaagcaaaggcaggcagcctccaaccgccgtgcccaggagctggtgcggatggacagcaacattcaagggattgaaaaccccggctttgaagcctcaccacctgcccaggggatacccgaggccaaagtcaggcaccccctgtcctatgtggcccagcggcagccttctgagtctgggcggcatctgctttcggagcccagcacccccctgtctcctccaggccccggagacgtcttcttcccatccctggaccctgtccctgactctccaaactttgaggtcatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 11 open reading frame 65 - inositol 1,3,4-triphosphate 5/6 kinase - cysteine-rich with EGF-like domains 2 - chromosome 19 open reading frame 62 |