Login to display prices
Login to display prices
C22orf29-chromosome 22 open reading frame 29 Gene View larger

C22orf29-chromosome 22 open reading frame 29 Gene

PTXBC011679

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf29-chromosome 22 open reading frame 29 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf29-chromosome 22 open reading frame 29 Gene

Proteogenix catalog: PTXBC011679
Ncbi symbol: C22orf29
Product name: C22orf29-chromosome 22 open reading frame 29 Gene
Size: 2ug
Accessions: BC011679
Gene id: 79680
Gene description: chromosome 22 open reading frame 29
Synonyms: BOP; protein Bop; BH3-only protein; chromosome 22 open reading frame 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcagaagagcacagctagtggcacttgtggcggtaaacctgcagaaaggggtcccctagctgggcacatgcccagctcccgaccccacagggtggacttctgctgggtaccaggctcagacccaggcacctttgatggctccccgtggctactggaccgcttcttggcccagctgggcgattacatgtccttccactttgagcactatcaggacaacatcagccgtgtctgcgagatcctcaggcgcctaacaggccgagcccaggcctgggcagccccctaccttgatggggacctgcccctgcctgacgattacgagctcttctgccaggatctcaaggaagttgttcaagacccgaacagttttgctgagtaccatgctgtggttacctgtcccctgcccctggcctccagccagctgccagtggcccctcagctgcctgtggtgaggcaatacttagctaggttcttagagggcctggcactcgacatgggtactgcccccaggtctttaccagccgccatggccacccctgctgtgtctgggtccaactctgtatctagaagtgctctgttcgagcagcagctgaccaaggagagcacccctgggcccaaggagcccccagtcctgcccagttctacatgtagctccaagcctggtcctgtggaaccagcctcttcccagccagaggaggcagcccccacacctgtccctagactgtcggagtcagctaatcctcctgcccagagaccagacccagctcatccaggaggtccaaaaccccagaaaacagaggaggaggttttggagacagagggagaccaggaggtgtccttaggtaccccacaggaggtggtggaggccccggagaccccaggagagccaccactttctcctgggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: