C22orf29-chromosome 22 open reading frame 29 Gene View larger

C22orf29-chromosome 22 open reading frame 29 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf29-chromosome 22 open reading frame 29 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf29-chromosome 22 open reading frame 29 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011679
Product type: DNA & cDNA
Ncbi symbol: C22orf29
Origin species: Human
Product name: C22orf29-chromosome 22 open reading frame 29 Gene
Size: 2ug
Accessions: BC011679
Gene id: 79680
Gene description: chromosome 22 open reading frame 29
Synonyms: BOP; protein Bop; BH3-only protein; chromosome 22 open reading frame 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcagaagagcacagctagtggcacttgtggcggtaaacctgcagaaaggggtcccctagctgggcacatgcccagctcccgaccccacagggtggacttctgctgggtaccaggctcagacccaggcacctttgatggctccccgtggctactggaccgcttcttggcccagctgggcgattacatgtccttccactttgagcactatcaggacaacatcagccgtgtctgcgagatcctcaggcgcctaacaggccgagcccaggcctgggcagccccctaccttgatggggacctgcccctgcctgacgattacgagctcttctgccaggatctcaaggaagttgttcaagacccgaacagttttgctgagtaccatgctgtggttacctgtcccctgcccctggcctccagccagctgccagtggcccctcagctgcctgtggtgaggcaatacttagctaggttcttagagggcctggcactcgacatgggtactgcccccaggtctttaccagccgccatggccacccctgctgtgtctgggtccaactctgtatctagaagtgctctgttcgagcagcagctgaccaaggagagcacccctgggcccaaggagcccccagtcctgcccagttctacatgtagctccaagcctggtcctgtggaaccagcctcttcccagccagaggaggcagcccccacacctgtccctagactgtcggagtcagctaatcctcctgcccagagaccagacccagctcatccaggaggtccaaaaccccagaaaacagaggaggaggttttggagacagagggagaccaggaggtgtccttaggtaccccacaggaggtggtggaggccccggagaccccaggagagccaccactttctcctgggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 38
- chromosome 10 open reading frame 54
- chromosome 11 open reading frame 65
- inositol 1,3,4-triphosphate 5/6 kinase

Buy C22orf29-chromosome 22 open reading frame 29 Gene now

Add to cart