DNASE1L1-deoxyribonuclease I-like 1 Gene View larger

DNASE1L1-deoxyribonuclease I-like 1 Gene

PTXBC001561

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNASE1L1-deoxyribonuclease I-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNASE1L1-deoxyribonuclease I-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001561
Product type: DNA & cDNA
Ncbi symbol: DNASE1L1
Origin species: Human
Product name: DNASE1L1-deoxyribonuclease I-like 1 Gene
Size: 2ug
Accessions: BC001561
Gene id: 1774
Gene description: deoxyribonuclease I-like 1
Synonyms: DNAS1L1; DNASEX; DNL1L; G4.8; XIB; deoxyribonuclease-1-like 1; DNase I, lysosomal-like; DNase I-like 1; DNase I-like, muscle-specific; deoxyribonuclease I-like 1; deoxyribonuclease 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcactacccaactgcactcctcttcctcatcctggccaatggggcccaggcctttcgcatctgcgccttcaatgcccagcggctgacactggccaaggtggccagggagcaggtgatggacaccttagttcggatactggctcgctgtgacatcatggtgctgcaggaggtggtggactcttccggcagcgccatccccctcctgcttcgagaactcaatcgatttgatggctctgggccctacagcaccctgagcagcccccagctggggcgcagcacctacatggagacgtatgtgtacttctatcggtcacacaaaacacaggtcctgagttcctacgtgtacaacgatgaggatgacgtctttgcccgggagccatttgtggcccagttctctttgcccagcaatgtccttcccagcctggtgttggtcccgctgcacaccactcctaaggccgtagagaaggagctgaacgccctctacgatgtgtttctggaggtctcccagcactggcagagcaaggacgtgatcctgcttggggacttcaatgctgactgcgcttcactgaccaaaaagcgcctggacaagctggagctgcggactgagccaggcttccactgggtgattgccgatggggaggacaccacagtgcgggccagcacccactgcacctatgaccgcgtcgtgctgcacggggagcgctgccggagtctgctgcacactgcggctgcctttgacttccccacgagcttccagctcaccgaggaggaggccctcaacatcagtgaccactaccccgtggaggtggagctgaagctgagccaggcacacagcgtccagcctctcagcctcactgttctgttgctgctatcactcctgtcccctcagctgtgccctgctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermatogenesis associated 7
- spermatogenesis associated 4
- melanoma antigen family A, 2
- melanoma antigen family A, 4

Buy DNASE1L1-deoxyribonuclease I-like 1 Gene now

Add to cart