Login to display prices
Login to display prices
SULT4A1-sulfotransferase family 4A, member 1 Gene View larger

SULT4A1-sulfotransferase family 4A, member 1 Gene

PTXBC022459

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SULT4A1-sulfotransferase family 4A, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SULT4A1-sulfotransferase family 4A, member 1 Gene

Proteogenix catalog: PTXBC022459
Ncbi symbol: SULT4A1
Product name: SULT4A1-sulfotransferase family 4A, member 1 Gene
Size: 2ug
Accessions: BC022459
Gene id: 25830
Gene description: sulfotransferase family 4A, member 1
Synonyms: BR-STL-1; BRSTL1; DJ388M5.3; NST; SULTX3; hBR-STL-1; sulfotransferase 4A1; ST4A1; brain sulfotransferase-like protein; hBR-STL; nervous system cytosolic sulfotransferase; nervous system sulfotransferase; sulfotransferase-related protein; sulfotransferase family 4A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagagcgaggccgagacccccagcaccccgggggagttcgagagcaagtacttcgagttccatggcgtgcggctgccgcccttctgccgcgggaagatggaggagatcgccaacttcccggtgcggcccagcgacgtgtggatcgtcacctaccccaagtccggcaccagcttgctgcaggaggtggtctacttggtgagccagggcgctgaccccgatgagatcggcttgatgaacatcgacgagcagctcccggtcctggagtacccacagccgggcctggacatcatcaaggaactgacctctccccgcctcatcaagagccacctgccctaccgctttctgccctctgacctccacaatggagactcaaaggtcatctatatggctcgcaaccccaaggatctggtggtgtcttattatcagttccaccgctctctgcggaccatgagctaccgaggcacctttcaagaattctgccggaggtttatgaatgataagctgggctacggctcctggtttgagcacgtgcaggagttctgggagcaccgcatggactcgaacgtgctttttctcaagtatgaagacatgcatcgggacctggtgacgatggtggagcagctggccagattcctgggggtgtcctgtgacaaggcccagctggaagccctgacggagcactgccaccagctggtggaccagtgctgcagcgctgaggccctgcccgtgggccggggaagagttgggctgtggaaggacatcttcaccgtctccatgaatgagaagtttgacttggtgtataaacagaagatgggaaagtgtgacctcacgtttgacttttatttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: