Login to display prices
Login to display prices
FAM124A-family with sequence similarity 124A Gene View larger

FAM124A-family with sequence similarity 124A Gene

PTXBC034497

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM124A-family with sequence similarity 124A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM124A-family with sequence similarity 124A Gene

Proteogenix catalog: PTXBC034497
Ncbi symbol: FAM124A
Product name: FAM124A-family with sequence similarity 124A Gene
Size: 2ug
Accessions: BC034497
Gene id: 220108
Gene description: family with sequence similarity 124A
Synonyms: protein FAM124A; family with sequence similarity 124A; family with sequence similarity 124 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacccaaaggcgggcggcggcggcgaggaggacgactgcgtggactcgggcgccgagaccggagggtccgactacagccacctgtcctccacgagcagtgagctttccgttgaagaggcgcaggaccctttcctggtcagcatccacataatcgcagacccaggggagtcccagcccctgcaggaggccatcgacaacgtcctggcgtggatccaccccgacctcccgctgttccgggtgtccgagaggcgggcgtcccggcggcggcggaagccccccaagggcgctcagccagcgctggctgtggtgctgttcctgcaggaggagtacggcgaagagcagatcctgcagctgcaccgcacactgcagcagccgccctggcgccaccaccacaccgagcaggtgcacggccggttcctgccctacctgccctgcagccaggacttcttcacgctggcccctgggacgccgctttgggccatccggcccgtgcactacggcaaggaaatcgtgcgcttcaccgtctactgtcgctacgacaactatgctgacagcctcaggttctaccagctgattctccggaggagccccagccagaagaaagcggacttctgcatcttccctattttttccaacctggatgtggacatccagttctccctgaaaagactgccctgtgaccagtgcccggtgcccaccgactcctccgtgctggagttccgagtgagggacataggcgagctcgtgcctctcctgcccaacccttgcagccccatcagcgaggggcgctggcagacggaggaccatgatgggaacaagatcctcctacaggtactggggggacgcctgtctctgtctgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: