FAM124A-family with sequence similarity 124A Gene View larger

FAM124A-family with sequence similarity 124A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM124A-family with sequence similarity 124A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM124A-family with sequence similarity 124A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034497
Product type: DNA & cDNA
Ncbi symbol: FAM124A
Origin species: Human
Product name: FAM124A-family with sequence similarity 124A Gene
Size: 2ug
Accessions: BC034497
Gene id: 220108
Gene description: family with sequence similarity 124A
Synonyms: protein FAM124A; family with sequence similarity 124A; family with sequence similarity 124 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacccaaaggcgggcggcggcggcgaggaggacgactgcgtggactcgggcgccgagaccggagggtccgactacagccacctgtcctccacgagcagtgagctttccgttgaagaggcgcaggaccctttcctggtcagcatccacataatcgcagacccaggggagtcccagcccctgcaggaggccatcgacaacgtcctggcgtggatccaccccgacctcccgctgttccgggtgtccgagaggcgggcgtcccggcggcggcggaagccccccaagggcgctcagccagcgctggctgtggtgctgttcctgcaggaggagtacggcgaagagcagatcctgcagctgcaccgcacactgcagcagccgccctggcgccaccaccacaccgagcaggtgcacggccggttcctgccctacctgccctgcagccaggacttcttcacgctggcccctgggacgccgctttgggccatccggcccgtgcactacggcaaggaaatcgtgcgcttcaccgtctactgtcgctacgacaactatgctgacagcctcaggttctaccagctgattctccggaggagccccagccagaagaaagcggacttctgcatcttccctattttttccaacctggatgtggacatccagttctccctgaaaagactgccctgtgaccagtgcccggtgcccaccgactcctccgtgctggagttccgagtgagggacataggcgagctcgtgcctctcctgcccaacccttgcagccccatcagcgaggggcgctggcagacggaggaccatgatgggaacaagatcctcctacaggtactggggggacgcctgtctctgtctgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidic acid phosphatase type 2C
- syndecan binding protein (syntenin) 2
- survival of motor neuron 2, centromeric
- chromosome 21 open reading frame 91

Buy FAM124A-family with sequence similarity 124A Gene now

Add to cart