Login to display prices
Login to display prices
SDCBP2-syndecan binding protein (syntenin) 2 Gene View larger

SDCBP2-syndecan binding protein (syntenin) 2 Gene

PTXBC002727

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDCBP2-syndecan binding protein (syntenin) 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDCBP2-syndecan binding protein (syntenin) 2 Gene

Proteogenix catalog: PTXBC002727
Ncbi symbol: SDCBP2
Product name: SDCBP2-syndecan binding protein (syntenin) 2 Gene
Size: 2ug
Accessions: BC002727
Gene id: 27111
Gene description: syndecan binding protein (syntenin) 2
Synonyms: SITAC; SITAC18; ST-2; syntenin-2; syndecan binding protein (syntenin) 2; syndecan binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatccctgtacccatctctagaggacctaaaagtggaccaagccattcaggcccaggtcagagcctcacccaagatgccagccctgccagtccaggcaacagccatttccccaccaccagttttgtacccaaacttggcagaactggaaaattatatgggtctttccctctccagccaagaagtccaggagagcctgcttcagattccagagggtgacagtacagcggtctcgggccccgggcccggccagatggtggcaccggtaaccgggtacagcctgggcgtgcggcgagctgagatcaagcccggggtgcgcgagatccacctgtgcaaggacgagcgcggcaagaccgggctgaggctgcggaaggtcgaccaggggctctttgtgcagttggtccaggccaacacccctgcatcccttgtggggctgcgctttggggaccagctcctgcagattgacgggcgtgactgtgctgggtggagctcgcacaaagcccatcaggtggtgaagaaggcatcaggcgataagattgtcgtggtggttcgggacaggccgttccagcggactgtcaccatgcacaaggacagcatgggccacgtcggcttcgtgatcaagaaggggaagattgtctctctggtcaaagggagttctgcggcccgcaacgggctcctcaccaaccactacgtgtgtgaggtagacgggcagaatgttatcgggctgaaggacaaaaagatcatggagattctggccacggctgggaacgttgtcaccctgaccatcatccccagtgtgatctacgagcacatggtcaaaaagttgcctccagtcctgctccaccacaccatggaccactccatcccagatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: