SDCBP2-syndecan binding protein (syntenin) 2 Gene View larger

SDCBP2-syndecan binding protein (syntenin) 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDCBP2-syndecan binding protein (syntenin) 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SDCBP2-syndecan binding protein (syntenin) 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002727
Product type: DNA & cDNA
Ncbi symbol: SDCBP2
Origin species: Human
Product name: SDCBP2-syndecan binding protein (syntenin) 2 Gene
Size: 2ug
Accessions: BC002727
Gene id: 27111
Gene description: syndecan binding protein (syntenin) 2
Synonyms: SITAC; SITAC18; ST-2; syntenin-2; syndecan binding protein (syntenin) 2; syndecan binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatccctgtacccatctctagaggacctaaaagtggaccaagccattcaggcccaggtcagagcctcacccaagatgccagccctgccagtccaggcaacagccatttccccaccaccagttttgtacccaaacttggcagaactggaaaattatatgggtctttccctctccagccaagaagtccaggagagcctgcttcagattccagagggtgacagtacagcggtctcgggccccgggcccggccagatggtggcaccggtaaccgggtacagcctgggcgtgcggcgagctgagatcaagcccggggtgcgcgagatccacctgtgcaaggacgagcgcggcaagaccgggctgaggctgcggaaggtcgaccaggggctctttgtgcagttggtccaggccaacacccctgcatcccttgtggggctgcgctttggggaccagctcctgcagattgacgggcgtgactgtgctgggtggagctcgcacaaagcccatcaggtggtgaagaaggcatcaggcgataagattgtcgtggtggttcgggacaggccgttccagcggactgtcaccatgcacaaggacagcatgggccacgtcggcttcgtgatcaagaaggggaagattgtctctctggtcaaagggagttctgcggcccgcaacgggctcctcaccaaccactacgtgtgtgaggtagacgggcagaatgttatcgggctgaaggacaaaaagatcatggagattctggccacggctgggaacgttgtcaccctgaccatcatccccagtgtgatctacgagcacatggtcaaaaagttgcctccagtcctgctccaccacaccatggaccactccatcccagatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - survival of motor neuron 2, centromeric
- chromosome 21 open reading frame 91
- mitochondrial carrier triple repeat 1
- chromosome 6 open reading frame 106

Buy SDCBP2-syndecan binding protein (syntenin) 2 Gene now

Add to cart