Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPAP2C-phosphatidic acid phosphatase type 2C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPAP2C-phosphatidic acid phosphatase type 2C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPAP2C |
| Origin species: | Human |
| Product name: | PPAP2C-phosphatidic acid phosphatase type 2C Gene |
| Size: | 2ug |
| Accessions: | BC002806 |
| Gene id: | 8612 |
| Gene description: | phosphatidic acid phosphatase type 2C |
| Synonyms: | PPAP2C; LPP2; PAP-2c; PAP2-g; phospholipid phosphatase 2; PAP2-gamma; PAP2c; lipid phosphate phosphohydrolase 2; phosphatidate phosphohydrolase type 2c; phosphatidic acid phosphatase 2c; phosphatidic acid phosphatase type 2C; phosphatidic acid phosphohydrolase type 2c; type-2 phosphatidic acid phosphatase-gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagcggaggtgggtcttcgtgctgctcgacgtgctgtgcttactggtcgcctccctgcccttcgctatcctgacgctggtgaacgccccgtacaagcgaggattttactgcggggatgactccatccggtacccctaccgtccagataccatcacccacgggctcatggctggggtcaccatcacggccaccgtcatccttgtctcggccggggaagcctacctggtgtacacagaccggctctattctcgctcggacttcaacaactacgtggctgctgtatacaaggtgctggggaccttcctgtttggggctgccgtgagccagtctctgacagacctggccaagtacatgattgggcgtctgaggcccaacttcctagccgtctgcgaccccgactggagccgggtcaactgctcggtctatgtgcagctggagaaggtgtgcaggggaaaccctgctgatgtcaccgaggccaggttgtctttctactcgggacactcttcctttgggatgtactgcatggtgttcttggcgctgtatgtgcaggcacgactctgttggaagtgggcacggctgctgcgacccacagtccagttcttcctggtggcctttgccctctacgtgggctacacccgcgtgtctgattacaaacaccactggagcgatgtccttgttggcctcctgcagggggcactggtggctgccctcactgtctgctacatctcagacttcttcaaagcccgacccccacagcactgtctgaaggaggaggagctggaacggaagcccagcctgtcactgacgttgaccctgggcgaggctgaccacaaccactatggatacccgcactcctcctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - syndecan binding protein (syntenin) 2 - survival of motor neuron 2, centromeric - chromosome 21 open reading frame 91 - mitochondrial carrier triple repeat 1 |