PPAP2C-phosphatidic acid phosphatase type 2C Gene View larger

PPAP2C-phosphatidic acid phosphatase type 2C Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPAP2C-phosphatidic acid phosphatase type 2C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPAP2C-phosphatidic acid phosphatase type 2C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002806
Product type: DNA & cDNA
Ncbi symbol: PPAP2C
Origin species: Human
Product name: PPAP2C-phosphatidic acid phosphatase type 2C Gene
Size: 2ug
Accessions: BC002806
Gene id: 8612
Gene description: phosphatidic acid phosphatase type 2C
Synonyms: PPAP2C; LPP2; PAP-2c; PAP2-g; phospholipid phosphatase 2; PAP2-gamma; PAP2c; lipid phosphate phosphohydrolase 2; phosphatidate phosphohydrolase type 2c; phosphatidic acid phosphatase 2c; phosphatidic acid phosphatase type 2C; phosphatidic acid phosphohydrolase type 2c; type-2 phosphatidic acid phosphatase-gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcggaggtgggtcttcgtgctgctcgacgtgctgtgcttactggtcgcctccctgcccttcgctatcctgacgctggtgaacgccccgtacaagcgaggattttactgcggggatgactccatccggtacccctaccgtccagataccatcacccacgggctcatggctggggtcaccatcacggccaccgtcatccttgtctcggccggggaagcctacctggtgtacacagaccggctctattctcgctcggacttcaacaactacgtggctgctgtatacaaggtgctggggaccttcctgtttggggctgccgtgagccagtctctgacagacctggccaagtacatgattgggcgtctgaggcccaacttcctagccgtctgcgaccccgactggagccgggtcaactgctcggtctatgtgcagctggagaaggtgtgcaggggaaaccctgctgatgtcaccgaggccaggttgtctttctactcgggacactcttcctttgggatgtactgcatggtgttcttggcgctgtatgtgcaggcacgactctgttggaagtgggcacggctgctgcgacccacagtccagttcttcctggtggcctttgccctctacgtgggctacacccgcgtgtctgattacaaacaccactggagcgatgtccttgttggcctcctgcagggggcactggtggctgccctcactgtctgctacatctcagacttcttcaaagcccgacccccacagcactgtctgaaggaggaggagctggaacggaagcccagcctgtcactgacgttgaccctgggcgaggctgaccacaaccactatggatacccgcactcctcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - syndecan binding protein (syntenin) 2
- survival of motor neuron 2, centromeric
- chromosome 21 open reading frame 91
- mitochondrial carrier triple repeat 1

Buy PPAP2C-phosphatidic acid phosphatase type 2C Gene now

Add to cart