Login to display prices
Login to display prices
FAM122A-family with sequence similarity 122A Gene View larger

FAM122A-family with sequence similarity 122A Gene

PTXBC013062

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM122A-family with sequence similarity 122A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM122A-family with sequence similarity 122A Gene

Proteogenix catalog: PTXBC013062
Ncbi symbol: FAM122A
Product name: FAM122A-family with sequence similarity 122A Gene
Size: 2ug
Accessions: BC013062
Gene id: 116224
Gene description: family with sequence similarity 122A
Synonyms: protein FAM122A; C9orf42; family with sequence similarity 122A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcaggagaagatggagctagacctggagctgcctccgggtacgggcgggagcccggcggagggcggtggcagcggcggcggcgggggcctcaggaggtctaacagcgcccccctgatccacggcctcagtgacacttcgccggtgttccaggccgaggcgccgagcgccaggcggaacagcacaacgttcccgagccgccacggcctgctgctgccggcctcccctgtccgcatgcacagcagccgcttgcaccagatcaaacaagaagagggcatggacttgatcaaccgagagacggtccacgaacgggaggtgcagaccgcaatgcagataagccactcctgggaggaaagtttcagcctgagtgacaacgacgtggagaaatccgcctcccccaagcgcatcgatttcattcctgtgtcaccagcaccgtcacccactcggggaattgggaagcagtgtttttcgccatccttgcaaagttttgtaagtagcaacggattgcctccaagccctattcccagcccaacgacccgatttaccacccggagaagccagagccccatcaattgcattagaccaagtgttcttggaccattgaaaagaaaatgtgaaatggaaactgaatatcagccaaagagatttttccagggcatcaccaacatgctttcttctgacgttgcacagctgtcagatcctggtgtgtgtgtatcttcggatacccttgatggaaacagcagcagtgccggatcttcttgtaactcaccagcgaaagtcagcactaccaccgactctcctgtgtcacctgcccaagcggcttctccatttattccactagatgaactttcgtctaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: