Login to display prices
Login to display prices
TMEM106B-transmembrane protein 106B Gene View larger

TMEM106B-transmembrane protein 106B Gene

PTXBC033901

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM106B-transmembrane protein 106B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM106B-transmembrane protein 106B Gene

Proteogenix catalog: PTXBC033901
Ncbi symbol: TMEM106B
Product name: TMEM106B-transmembrane protein 106B Gene
Size: 2ug
Accessions: BC033901
Gene id: 54664
Gene description: transmembrane protein 106B
Synonyms: transmembrane protein 106B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaagtctctttctcatttgcctttgcattcaagcaaagaagatgcttatgatggagtcacatctgaaaacatgaggaatggactggttaatagtgaagtccataatgaagatggaagaaatggagatgtctctcagtttccatatgtggaatttacaggaagagatagtgtcacctgccctacttgtcagggaacaggaagaattcctagggggcaagaaaaccaactggtggcattgattccatatagtgatcagagattaaggccaagaagaacaaagctgtatgtgatggcttctgtgtttgtctgtctactcctttctggattggctgtgtttttccttttccctcgctctatcgacgtgaaatacattggtgtaaaatcagcctatgtcagttatgatgttcagaagcgtacaatttatttaaatatcacaaacacactaaatataacaaacaataactattactctgtcgaagttgaaaacatcactgcccaagttcaattttcaaaaacagttattggaaaggcacgcttaaacaacataaccattattggtccacttgatatgaaacaaattgattacacagtacctaccgttatagcagaggaaatgagttatatgtatgatttctgtactctgatatccatcaaagtgcataacatagtactcatgatgcaagttactgtgacaacaacatactttggccactctgaacagatatcccaggagaggtatcagtatgtcgactgtggaagaaacacaacttatcagttggggcagtctgaatatttaaatgtacttcagccacaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: