VGLL4-vestigial like 4 (Drosophila) Gene View larger

VGLL4-vestigial like 4 (Drosophila) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VGLL4-vestigial like 4 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VGLL4-vestigial like 4 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001514
Product type: DNA & cDNA
Ncbi symbol: VGLL4
Origin species: Human
Product name: VGLL4-vestigial like 4 (Drosophila) Gene
Size: 2ug
Accessions: BC001514
Gene id: 9686
Gene description: vestigial like 4 (Drosophila)
Synonyms: VGL-4; transcription cofactor vestigial-like protein 4; Vestigial-like 4; vestigial like 4; vestigial like family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgccattggatgttttgtccagggcagcatctctggtgcatgctgatgacgaaaaacgcgaagctgctctcaggggagaacccagaatgcagaccctgccggtggcctctgccctcagcagtcaccgcaccggccctcccccaatcagccccagcaagaggaagttcagcatggagccaggtgacgaggacctagactgtgacaacgaccacgtctccaaaatgagtcgcatcttcaacccccatctgaacaagactgccaatggagactgccgcagagacccccgggagcggagccgcagccccatcgagcgcgctgtggcccccaccatgagcctgcacggcagccacctgtacacctccctccccagccttggcctggagcagcccctcgcactgaccaagaacagcctggacgccagcaggccagccggcctctcgcccacactgaccccgggggagcggcagcagaaccggccctccgtgatcacctgtgcctcggctggcgcccgcaactgcaacctctcgcactgccccatcgcgcacagcggctgtgccgcgcccgggcctgccagctaccggaggccaccgagcgctgccaccacctgtgaccccgtggtggaggagcatttccgcaggagcctgggcaagaattacaaggagcccgagccggcacccaactccgtgtccatcacgggctccgtggacgaccactttgccaaagctctgggtgacacgtggctccagatcaaagcggccaaggacggagcatccagcagccctgagtccgcctctcgcaggggccagcccgccagcccctctgcccacatggtcagccacagtcactccccctctgtggtctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aquaporin 3 (Gill blood group)
- TBC1 domain family, member 7
- deoxyribonuclease I-like 2
- ligase III, DNA, ATP-dependent

Buy VGLL4-vestigial like 4 (Drosophila) Gene now

Add to cart