Cart 37 Product Products 8 336,10 € (empty)
-
1 x HIATL1-hip...121,50 € -
-
1 x PIP4K2A-ph...121,50 € -
1 x FAM177A1-f...113,40 € -
1 x DUSP6-dual...121,50 € -
1 x S100B-S100...113,40 € -
1 x NCOA7-nucl...113,40 € -
-
-
1 x PIP4K2B-ph...121,50 € -
1 x FAM176A-fa...113,40 € -
1 x ZZZ3-zinc...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PIK3R5-pho...121,50 € -
1 x GPR1-G...121,50 € -
-
1 x RPA3-repli...113,40 € -
1 x DYNLRB1-dy...113,40 € -
1 x PIM1-pim-1...121,50 € -
1 x FAM133A-fa...113,40 € -
-
-
1 x RPL13-ribo...113,40 € -
1 x DUSP7-dual...121,50 € -
1 x PIPOX-pipe...121,50 € -
1 x PID1-phosp...113,40 € -
1 x TMEM116-tr...113,40 € -
1 x DYNLRB2-dy...113,40 € -
1 x FAM128B-fa...113,40 € -
-
-
1 x FAM118B-fa...121,50 € -
1 x CDO1-cyste...113,40 € -
1 x TMEM110-tr...121,50 € -
-
-
1 x FAM171A2-f...113,40 €
No products
To be determined Shipping
8 336,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 336,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 336,10 €
Data sheet of VGLL4-vestigial like 4 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VGLL4-vestigial like 4 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VGLL4 |
| Origin species: | Human |
| Product name: | VGLL4-vestigial like 4 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC001514 |
| Gene id: | 9686 |
| Gene description: | vestigial like 4 (Drosophila) |
| Synonyms: | VGL-4; transcription cofactor vestigial-like protein 4; Vestigial-like 4; vestigial like 4; vestigial like family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacgccattggatgttttgtccagggcagcatctctggtgcatgctgatgacgaaaaacgcgaagctgctctcaggggagaacccagaatgcagaccctgccggtggcctctgccctcagcagtcaccgcaccggccctcccccaatcagccccagcaagaggaagttcagcatggagccaggtgacgaggacctagactgtgacaacgaccacgtctccaaaatgagtcgcatcttcaacccccatctgaacaagactgccaatggagactgccgcagagacccccgggagcggagccgcagccccatcgagcgcgctgtggcccccaccatgagcctgcacggcagccacctgtacacctccctccccagccttggcctggagcagcccctcgcactgaccaagaacagcctggacgccagcaggccagccggcctctcgcccacactgaccccgggggagcggcagcagaaccggccctccgtgatcacctgtgcctcggctggcgcccgcaactgcaacctctcgcactgccccatcgcgcacagcggctgtgccgcgcccgggcctgccagctaccggaggccaccgagcgctgccaccacctgtgaccccgtggtggaggagcatttccgcaggagcctgggcaagaattacaaggagcccgagccggcacccaactccgtgtccatcacgggctccgtggacgaccactttgccaaagctctgggtgacacgtggctccagatcaaagcggccaaggacggagcatccagcagccctgagtccgcctctcgcaggggccagcccgccagcccctctgcccacatggtcagccacagtcactccccctctgtggtctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aquaporin 3 (Gill blood group) - TBC1 domain family, member 7 - deoxyribonuclease I-like 2 - ligase III, DNA, ATP-dependent |