AQP3-aquaporin 3 (Gill blood group) Gene View larger

AQP3-aquaporin 3 (Gill blood group) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AQP3-aquaporin 3 (Gill blood group) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AQP3-aquaporin 3 (Gill blood group) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013566
Product type: DNA & cDNA
Ncbi symbol: AQP3
Origin species: Human
Product name: AQP3-aquaporin 3 (Gill blood group) Gene
Size: 2ug
Accessions: BC013566
Gene id: 360
Gene description: aquaporin 3 (Gill blood group)
Synonyms: AQP-3; GIL; aquaporin-3; aquaglyceroporin-3; aquaporin 3 (GIL blood group); aquaporin 3 (Gill blood group)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcgacagaaggagctggtgtcccgctgcggggagatgctccacatccgctaccggctgctccgacaggcgctggccgagtgcctggggaccctcatcctggtgatgtttggctgtggctccgtggcccaggttgtgctcagccggggcacccacggtggtttcctcaccatcaacctggcctttggctttgctgtcactctgggcatcctcatcgctggccaggtctctggggcccacctgaaccctgccgtgacctttgccatgtgcttcctggctcgtgagccctggatcaagctgcccatctacaccctggcacagacgctgggagccttcttgggtgctggaatagtttttgggctgtattatgatgcaatctggcacttcgccgacaaccagctttttgtttcgggccccaatggcacagccggcatctttgctacctacccctctggacacttggatatgatcaatggcttctttgaccagttcataggcacagcctcccttatcgtgtgtgtgctggccattgttgacccctacaacaaccccgtcccccgaggcctggaggccttcaccgtgggcctggtggtcctggtcattggcacctccatgggcttcaactccggctatgccgtcaaccctgcccgggactttggcccccgcctttttacagcccttgcgggctggggctctgcagtcttcacgaccggccagcattggtggtgggtgcccatcgtgtccccactcctgggctccattgcgggtgtcttcgtgtaccagctgatgatcggctgccacctggagcagcccccaccctccaacgaggaagagaatgtgaagctggcccatgtgaagcacaaggagcagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TBC1 domain family, member 7
- deoxyribonuclease I-like 2
- ligase III, DNA, ATP-dependent
- GTPase, IMAP family member 7

Buy AQP3-aquaporin 3 (Gill blood group) Gene now

Add to cart