ARMC1-armadillo repeat containing 1 Gene View larger

ARMC1-armadillo repeat containing 1 Gene

PTXBC011607

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARMC1-armadillo repeat containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARMC1-armadillo repeat containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011607
Product type: DNA & cDNA
Ncbi symbol: ARMC1
Origin species: Human
Product name: ARMC1-armadillo repeat containing 1 Gene
Size: 2ug
Accessions: BC011607
Gene id: 55156
Gene description: armadillo repeat containing 1
Synonyms: Arcp; armadillo repeat-containing protein 1; armadillo repeat containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattcttccacttccaccatgagtgaagagcctgacgctctatcggtagttaaccagttacgggatctagcagcagatccgttaaacagaagagccatcgtccaggatcagggatgtctgcctggccttattttatttatggaccatcccaaccctccagtcgtccactccgctttgcttgctcttcgatacttggcagaatgccgtgcaaacagagaaaagatgaaaggagaactgggtatgatgttgagcttacaaaatgttatacagaaaactacaactccaggagaaacaaaacttctggcctctgaaatctatgacattcttcagtcctccaatatggcagatggtgatagttttaatgagatgaattcacgtcgaaggaaagctcaattttttctgggaactacaaacaaacgtgccaaaacagtggttttgcatatagatggccttgatgatacgtctcggagaaatctatgtgaagaggctttgttaaaaattaaaggtgttattagctttacttttcaaatggctgttcaaaggtgtgtggtgcgaatccgttcagatttgaaagctgaggctttggcatcagcaatagcatcaaccaaggttatgaaagctcagcaagttgtgaaaagtgaaagtggagaagagatgttggtcccattccaagatactcctgtggaagttgaacagaacacagagctacctgactacctgcctgaggatgagagtcccacaaaggaacaggacaaagcggtgtcccgggtcggctcacacccagaaggtggagctagctggcttagcacagctgcaaactttttatccagatcattttattggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi phosphoprotein 3-like
- vestigial like 4 (Drosophila)
- aquaporin 3 (Gill blood group)
- TBC1 domain family, member 7

Buy ARMC1-armadillo repeat containing 1 Gene now

Add to cart