GOLPH3L-golgi phosphoprotein 3-like Gene View larger

GOLPH3L-golgi phosphoprotein 3-like Gene

PTXBC013870

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOLPH3L-golgi phosphoprotein 3-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GOLPH3L-golgi phosphoprotein 3-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013870
Product type: DNA & cDNA
Ncbi symbol: GOLPH3L
Origin species: Human
Product name: GOLPH3L-golgi phosphoprotein 3-like Gene
Size: 2ug
Accessions: BC013870
Gene id: 55204
Gene description: golgi phosphoprotein 3-like
Synonyms: GPP34R; Golgi phosphoprotein 3-like; GPP34-related protein; golgi phosphoprotein 3 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccactttaactcaccgggcccgtcgcactgaaataagcaagaactctgaaaagaagatggaaagtgaggaagacagtaattgggagaaaagtccagacaatgaagattctggagactctaaggatatccgccttactcttatggaagaagtattgcttctgggactaaaagataaagaggggtacacatctttctggaatgactgcatatcatcaggcctgcgagggggcatcctgatagagctggccatgcggggtcgaatctatctggaacccccgaccatgcgtaagaagcgactactagacagaaaggtactgctaaagtcagacagcccaacaggtgatgttttactggatgaaactctgaaacacatcaaagcaactgaacccacagaaactgtccaaacatggatagagctactcactggtgagacctggaaccccttcaaattacagtaccagctgagaaatgtacgagagcgcatcgcaaagaacctagtagagaaaggtattctaaccactgagaagcagaatttcctgctatttgacatgactactcatccagtgaccaatacaacagagaaacagcgactagtgaaaaaacttcaagatagtgtactagagcggtgggtaaatgaccctcagcgtatggacaagcgaacactagcactcctggtgctagcccactcctctgatgtgctagagaatgtcttctcctctctgacagatgacaagtatgatgtggcaatgaatcgagccaaggacttagtagaactggaccctgaagtggaagggacaaagcctagtgccacagaaatgatctgggctgtgctggcagccttcaataaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vestigial like 4 (Drosophila)
- aquaporin 3 (Gill blood group)
- TBC1 domain family, member 7
- deoxyribonuclease I-like 2

Buy GOLPH3L-golgi phosphoprotein 3-like Gene now

Add to cart