Login to display prices
Login to display prices
GOLPH3L-golgi phosphoprotein 3-like Gene View larger

GOLPH3L-golgi phosphoprotein 3-like Gene

PTXBC013870

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOLPH3L-golgi phosphoprotein 3-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GOLPH3L-golgi phosphoprotein 3-like Gene

Proteogenix catalog: PTXBC013870
Ncbi symbol: GOLPH3L
Product name: GOLPH3L-golgi phosphoprotein 3-like Gene
Size: 2ug
Accessions: BC013870
Gene id: 55204
Gene description: golgi phosphoprotein 3-like
Synonyms: GPP34R; Golgi phosphoprotein 3-like; GPP34-related protein; golgi phosphoprotein 3 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccactttaactcaccgggcccgtcgcactgaaataagcaagaactctgaaaagaagatggaaagtgaggaagacagtaattgggagaaaagtccagacaatgaagattctggagactctaaggatatccgccttactcttatggaagaagtattgcttctgggactaaaagataaagaggggtacacatctttctggaatgactgcatatcatcaggcctgcgagggggcatcctgatagagctggccatgcggggtcgaatctatctggaacccccgaccatgcgtaagaagcgactactagacagaaaggtactgctaaagtcagacagcccaacaggtgatgttttactggatgaaactctgaaacacatcaaagcaactgaacccacagaaactgtccaaacatggatagagctactcactggtgagacctggaaccccttcaaattacagtaccagctgagaaatgtacgagagcgcatcgcaaagaacctagtagagaaaggtattctaaccactgagaagcagaatttcctgctatttgacatgactactcatccagtgaccaatacaacagagaaacagcgactagtgaaaaaacttcaagatagtgtactagagcggtgggtaaatgaccctcagcgtatggacaagcgaacactagcactcctggtgctagcccactcctctgatgtgctagagaatgtcttctcctctctgacagatgacaagtatgatgtggcaatgaatcgagccaaggacttagtagaactggaccctgaagtggaagggacaaagcctagtgccacagaaatgatctgggctgtgctggcagccttcaataaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: