Cart 23 Product Products 2 878,23 € (empty)
-
1 x SRI-sorcin...113,40 € -
1 x RGS13-regu...113,40 € -
-
1 x GPR4-G...121,50 € -
-
1 x TM4SF1-tra...113,40 € -
1 x C5orf30-ch...113,40 € -
1 x CKS2-CDC28...113,40 € -
1 x KLHL17-kel...113,40 € -
1 x MEST-mesod...121,50 € -
1 x PRR7-proli...121,50 € -
-
1 x C20orf54-c...121,50 € -
1 x CXCL13-che...113,40 € -
1 x MMS19-MMS1...121,50 € -
1 x ST8SIA1-ST...113,40 € -
-
1 x FOXA3-fork...121,50 € -
1 x TNNC2-trop...113,40 € -
1 x SNX24-sort...113,40 € -
1 x CDC42EP4-C...121,50 € -
-
1 x CXCL16-che...121,50 €
No products
To be determined Shipping
2 878,23 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 878,23 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 878,23 €
Data sheet of PBX3-pre-B-cell leukemia homeobox 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PBX3-pre-B-cell leukemia homeobox 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016977 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PBX3 |
| Origin species: | Human |
| Product name: | PBX3-pre-B-cell leukemia homeobox 3 Gene |
| Size: | 2ug |
| Accessions: | BC016977 |
| Gene id: | 5090 |
| Gene description: | pre-B-cell leukemia homeobox 3 |
| Synonyms: | homeobox protein PBX3; pre-B-cell leukemia transcription factor 3; pre-B-cell leukemia homeobox 3; PBX homeobox 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcgtaacttcagtaaacaggccacagaaatcttgaatgaatatttttactcacacctcagcaacccctaccccagtgaagaagccaaagaggagctggccaagaaatgcagcatcacagtgtcacagagtcttgtaaaggatccaaaagaaagagggagcaaaggttctgacatccagccaactagcgtggtatccaattggtttggcaacaaacgaatcaggtacaagaagaacattggcaagtttcaggaagaagccaacctctatgctgcaaagacggccgtgacagctgcacacgcagtagcagcagctgtgcagaacaaccagaccaattcgcccaccacaccaaattccggttcttctggttcttttaacctcccaaattctggggacatgttcatgaacatgcagagtctgaatggggattcttaccaagggtcccaagtcggagccaatgtgcaatcacaggtggataccctccgtcatgttatcaatcagacgggaggctacagtgatggccttggaggaaattcactgtacagtccacataatttaaatgctaatggaggctggcaggacgcaacaactccatcttctgtgacttctcctacagaaggcccaggaagtgtgcactcggatacctctaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 106B - armadillo repeat containing 1 - golgi phosphoprotein 3-like - vestigial like 4 (Drosophila) |