C1orf89-chromosome 1 open reading frame 89 Gene View larger

C1orf89-chromosome 1 open reading frame 89 Gene

PTXBC002946

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf89-chromosome 1 open reading frame 89 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf89-chromosome 1 open reading frame 89 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002946
Product type: DNA & cDNA
Ncbi symbol: C1orf89
Origin species: Human
Product name: C1orf89-chromosome 1 open reading frame 89 Gene
Size: 2ug
Accessions: BC002946
Gene id: 79363
Gene description: chromosome 1 open reading frame 89
Synonyms: miro domain-containing protein C1orf89; C1orf89; REM2- and Rab-like small GTPase 1; Rem/Rab-Similar GTPase 1; REM2 and RAB like small GTPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagacctcccgtgcccggttcggtggttgtcccaaactggcacgagagtgccgagggcaaggagtacctggcttgcattctgcgcaagaaccgccggcgggtgtttgggctgcttgagcggccagtgctgctgccgcctgtgtccattgacactgccagctacaagatctttgtgtccgggaagagtggtgtgggcaagacggcgctggtggccaagctggctggcctggaggtgcctgtggtgcaccacgggaccaccggcatccagaccaccgtggtattttggccagccaagctgcaggccagcagccgtgtcgtcatgtttcgttttgagttctgggactgtggagagtctgcactcaaaaagttcgatcatatgctgctggcttgcatggagaacacagatgccttcctcttcctcttctccttcactgaccgtgcctcctttgaagacctccctggacagctggcccgcatagcaggtgaggcccctggtgtcgtcaggatggtcatcggctccaaatttgaccagtacatgcacacggacgtgcccgagcgggacctcacagccttccggcaggcctgggagctgcccctgctacgggtgaagagtgtgccggggcggcggctggctgatgggcgcacactggacgggcgggctgggctggccgacgttgcccacatactcaatggccttgctgagcagctgtggcaccaggaccaggtggcggctggcctgcttcccaaccccccagagagtgctcctgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 5 open reading frame 44
- TGF beta-inducible nuclear protein 1
- mitochondrial ribosomal protein L10
- chromosome 9 open reading frame 24

Buy C1orf89-chromosome 1 open reading frame 89 Gene now

Add to cart