Login to display prices
Login to display prices
C9orf24-chromosome 9 open reading frame 24 Gene View larger

C9orf24-chromosome 9 open reading frame 24 Gene

PTXBC022084

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf24-chromosome 9 open reading frame 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf24-chromosome 9 open reading frame 24 Gene

Proteogenix catalog: PTXBC022084
Ncbi symbol: C9orf24
Product name: C9orf24-chromosome 9 open reading frame 24 Gene
Size: 2ug
Accessions: BC022084
Gene id: 84688
Gene description: chromosome 9 open reading frame 24
Synonyms: CBE1; NYD-SP22; SMRP1; bA573M23.4; spermatid-specific manchette-related protein 1; ciliated bronchial epithelial protein 1; testis development protein NYD-SP22; chromosome 9 open reading frame 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcctgttctcccgtaagaccaggacccctatcagtacctacagtgactcctacagggctcccacctccatcaaggaggtctataaggacccacccctgtgtgcctgggaagccaacaagtttctgactccgggtctgactcataccatggagcgacatgtggatcccgaagccctgcagaagatggccaaatgtgctgtacaggactacacttatagggggtccatatcaggccacccctacttgcctgagaagtactggctttctcaagaggaagcagacaaatgcagcccaaactacctgggcagtgactggtacaacacatggaggatggaaccttacaacagcagctgctgcaacaagtataccacctaccttcctcggctgcctaaggaggccaggatggagacagcagttcgaggaatgcccttggaatgccctcctaggccggagcggctcaatgcctacgagcgcgaagtgatggtgaacatgctgaactcactgtcgcggaaccagcagctgccgcggatcacgccccgatgcgggtgcgtggacccgctgcccggccgcctgcccttccatggttacgaaagtgcttgctcgggccgccactactgtctgcgcgggatggactactacgccagcggggcgccctgcaccgaccgccgcctgcggccttggtgccgggagcaaccgactatgtgtacctccctacgagcaccggcccggaatgcagtgtgctgttacaactcccccgccgtcatactacccatatccgaaccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: