Login to display prices
Login to display prices
GNPDA2-glucosamine-6-phosphate deaminase 2 Gene View larger

GNPDA2-glucosamine-6-phosphate deaminase 2 Gene

PTXBC015532

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNPDA2-glucosamine-6-phosphate deaminase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNPDA2-glucosamine-6-phosphate deaminase 2 Gene

Proteogenix catalog: PTXBC015532
Ncbi symbol: GNPDA2
Product name: GNPDA2-glucosamine-6-phosphate deaminase 2 Gene
Size: 2ug
Accessions: BC015532
Gene id: 132789
Gene description: glucosamine-6-phosphate deaminase 2
Synonyms: GNP2; SB52; glucosamine-6-phosphate isomerase 2; glcN6P deaminase 2; glucosamine-6-phosphate isomerase SB52; glucosamine-6-phosphate deaminase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcttgtaattcttgataactatgacttggctagtgaatgggcagccaaatacatctgtaatcgcatcattcagttcaaacctggacaggacagatattttacactgggtttaccaacagggagtacacctttaggatgctataaaaaactaatagaatatcataagaatggacacctttcttttaaatatgtgaagacctttaatatggatgaatatgtaggacttccaagaaatcatcctgaaagctaccattcttatatgtggaataatttttttaagcatatcgatatagatcctaataatgcacatatccttgacgggaatgctgcagatttacaagcagaatgtgatgcttttgaaaacaaaataaaagaagctggaggaatagatctttttgttggaggaattggtccagatggtcatatcgctttcaatgagcctggatccagtttagtgtcaaggacaagattaaagactctagcaatggataccatcttggcaaatgccaaatattttgatggagatttatcaaaagtgtcaactatggctctaactgttggtgtggggacagtgatggatgctagagaagtaatgatccttataacaggggcacacaaggcatttgccctgtacaaagcaatagaaggagtcaatcacatgtggactgtttccgctttccagcagcatccccggactatttttgtatgcgatgaagatgctactttagaattaagagttaaaactgtgaaatactttaaaggtctaatgcatgtgcacaataaacttgtggatccactattcagtatgaaagatggaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: