Cart 11 Product Products 4 226,00 € (empty)
No products
To be determined Shipping
4 226,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 226,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 226,00 €
Data sheet of HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HAAO |
| Origin species: | Human |
| Product name: | HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene |
| Size: | 2ug |
| Accessions: | BC029510 |
| Gene id: | 23498 |
| Gene description: | 3-hydroxyanthranilate 3,4-dioxygenase |
| Synonyms: | 3-HAO; HAO; 3-hydroxyanthranilate 3,4-dioxygenase; 3-hydroxyanthranilate oxygenase; 3-hydroxyanthranilic acid dioxygenase; HAD |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcgccgcctgggagtgagggcctgggtgaaggagaaccggggctccttccagcccccggtctgcaacaagctcatgcaccaggagcagctcaaagtcatgttcatcggaggccccaacaccaggaaggactatcacatcgaagagggtgaagaggtattttaccagctggagggagacatggttctccgagtcctggagcaagggaaacaccgggatgtggtcattcggcagggagagatattcctcctgcctgccagggtgccccactcaccacagaggtttgccaacaccgtggggctggtggttgagcgaaggcggctggagaccgagctagatgggctcaggtactatgtgggcgacaccatggacgttctgtttgagaagtggttctactgcaaggacctcggcacgcagttggcccccatcatccaggagttcttcagctctgagcagtacagaacaggaaagcccatccctgaccagctgctcaaggagccaccattccctctaagcacacgatccatcatggagcccatgtccctggatgcctggctggacagccaccacagggagctgcaggcaggcacaccactcagcctgtttggggacacctatgagacccaggtgatcgcctatgggcaaggcagcagcgaaggcctgagacagaatgtggacgtgtggctgtggcagctggagggctcctcggtggtgacaatggggggacggcgcctgagcctggcccctgatgacagcctcctggtgctagctgggacctcgtatgcctgggagcgaacacaaggctctgtggccctgtctgtgacccaggaccctgcctgcaagaagcccctggggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glucosamine-6-phosphate deaminase 1 - chromosome 9 open reading frame 78 - chromosome 8 open reading frame 76 - chromosome 3 open reading frame 49 |