HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene View larger

HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene

PTXBC029510

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029510
Product type: DNA & cDNA
Ncbi symbol: HAAO
Origin species: Human
Product name: HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene
Size: 2ug
Accessions: BC029510
Gene id: 23498
Gene description: 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms: 3-HAO; HAO; 3-hydroxyanthranilate 3,4-dioxygenase; 3-hydroxyanthranilate oxygenase; 3-hydroxyanthranilic acid dioxygenase; HAD
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgccgcctgggagtgagggcctgggtgaaggagaaccggggctccttccagcccccggtctgcaacaagctcatgcaccaggagcagctcaaagtcatgttcatcggaggccccaacaccaggaaggactatcacatcgaagagggtgaagaggtattttaccagctggagggagacatggttctccgagtcctggagcaagggaaacaccgggatgtggtcattcggcagggagagatattcctcctgcctgccagggtgccccactcaccacagaggtttgccaacaccgtggggctggtggttgagcgaaggcggctggagaccgagctagatgggctcaggtactatgtgggcgacaccatggacgttctgtttgagaagtggttctactgcaaggacctcggcacgcagttggcccccatcatccaggagttcttcagctctgagcagtacagaacaggaaagcccatccctgaccagctgctcaaggagccaccattccctctaagcacacgatccatcatggagcccatgtccctggatgcctggctggacagccaccacagggagctgcaggcaggcacaccactcagcctgtttggggacacctatgagacccaggtgatcgcctatgggcaaggcagcagcgaaggcctgagacagaatgtggacgtgtggctgtggcagctggagggctcctcggtggtgacaatggggggacggcgcctgagcctggcccctgatgacagcctcctggtgctagctgggacctcgtatgcctgggagcgaacacaaggctctgtggccctgtctgtgacccaggaccctgcctgcaagaagcccctggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glucosamine-6-phosphate deaminase 1
- chromosome 9 open reading frame 78
- chromosome 8 open reading frame 76
- chromosome 3 open reading frame 49

Buy HAAO-3-hydroxyanthranilate 3,4-dioxygenase Gene now

Add to cart