Login to display prices
Login to display prices
C9orf78-chromosome 9 open reading frame 78 Gene View larger

C9orf78-chromosome 9 open reading frame 78 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf78-chromosome 9 open reading frame 78 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf78-chromosome 9 open reading frame 78 Gene

Proteogenix catalog: PTXBC007664
Ncbi symbol: C9orf78
Product name: C9orf78-chromosome 9 open reading frame 78 Gene
Size: 2ug
Accessions: BC007664
Gene id: 51759
Gene description: chromosome 9 open reading frame 78
Synonyms: uncharacterized protein C9orf78; HCA59; HSPC220; bA409K20.3; hepatocellular carcinoma-associated antigen 59; chromosome 9 open reading frame 78
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtcgtccggaagattttccgtcgccgccggggcgactcggagtcagaggaagatgagcaggactcagaggaggttcgattaaaactggaagagaccagagaggtacagaacttgaggaagaggcccaacggggtgagtgctgtggccttgctggtgggagagaaggtacaagaggagaccactctagtggatgatccctttcagatgaagacaggtggtatggtggatatgaagaaactgaaggaaaggggcaaagataagatcagtgaggaggaggacctgcacctggggacatcgttttctgcagaaaccaaccgaagggatgaggatgcagacatgatgaagtacattgagacagagctaaagaagaggaaagggatcgtggaacatgaggaacagaaagttaagccaaagaatgcagaggactgtctttatgaacttccagaaaacatccgtgtttcctcagcaaagaagaccgaggagatgctttccaaccagatgctgagtggcattcctgaggtggacctgggcatcgatgctaaaataaaaaatatcatttccacggaggatgccaaggcccgtctgctggcagagcagcagaacaagaagaaagacagcgagacctccttcgtgcctaccaacatggctgtgaattatgtgcagcacaacagattttatcatgaggagctcaacgcgcccatacggagaaacaaagaagagcccaaggcccggcccttgagagtaggtgacacggagaagccagagcctgagcggtcccctcctaaccgcaagcgtcctgctaacgagaaggcaactgatgactatcattatgagaagttcaagaaaatgaataggcggtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: