C9orf78-chromosome 9 open reading frame 78 Gene View larger

C9orf78-chromosome 9 open reading frame 78 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf78-chromosome 9 open reading frame 78 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf78-chromosome 9 open reading frame 78 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007664
Product type: DNA & cDNA
Ncbi symbol: C9orf78
Origin species: Human
Product name: C9orf78-chromosome 9 open reading frame 78 Gene
Size: 2ug
Accessions: BC007664
Gene id: 51759
Gene description: chromosome 9 open reading frame 78
Synonyms: uncharacterized protein C9orf78; HCA59; HSPC220; bA409K20.3; hepatocellular carcinoma-associated antigen 59; chromosome 9 open reading frame 78
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtcgtccggaagattttccgtcgccgccggggcgactcggagtcagaggaagatgagcaggactcagaggaggttcgattaaaactggaagagaccagagaggtacagaacttgaggaagaggcccaacggggtgagtgctgtggccttgctggtgggagagaaggtacaagaggagaccactctagtggatgatccctttcagatgaagacaggtggtatggtggatatgaagaaactgaaggaaaggggcaaagataagatcagtgaggaggaggacctgcacctggggacatcgttttctgcagaaaccaaccgaagggatgaggatgcagacatgatgaagtacattgagacagagctaaagaagaggaaagggatcgtggaacatgaggaacagaaagttaagccaaagaatgcagaggactgtctttatgaacttccagaaaacatccgtgtttcctcagcaaagaagaccgaggagatgctttccaaccagatgctgagtggcattcctgaggtggacctgggcatcgatgctaaaataaaaaatatcatttccacggaggatgccaaggcccgtctgctggcagagcagcagaacaagaagaaagacagcgagacctccttcgtgcctaccaacatggctgtgaattatgtgcagcacaacagattttatcatgaggagctcaacgcgcccatacggagaaacaaagaagagcccaaggcccggcccttgagagtaggtgacacggagaagccagagcctgagcggtcccctcctaaccgcaagcgtcctgctaacgagaaggcaactgatgactatcattatgagaagttcaagaaaatgaataggcggtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 76
- chromosome 3 open reading frame 49
- dehydrodolichyl diphosphate synthase
- chromosome 2 open reading frame 25

Buy C9orf78-chromosome 9 open reading frame 78 Gene now

Add to cart