C8orf76-chromosome 8 open reading frame 76 Gene View larger

C8orf76-chromosome 8 open reading frame 76 Gene

PTXBC012379

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf76-chromosome 8 open reading frame 76 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf76-chromosome 8 open reading frame 76 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012379
Product type: DNA & cDNA
Ncbi symbol: C8orf76
Origin species: Human
Product name: C8orf76-chromosome 8 open reading frame 76 Gene
Size: 2ug
Accessions: BC012379
Gene id: 84933
Gene description: chromosome 8 open reading frame 76
Synonyms: uncharacterized protein C8orf76; chromosome 8 open reading frame 76
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaaggaagctgtggcaatggttttatgaagaaacagaaagcagtgatgatgttgaagtgctgactctcaagaaattcaaaggagacctggcctacagacgacaagagtatcagaaagcactgcaggagtattccagtatctctgaaaaattgtcatcaaccaattttgccatgaaaagggatgtccaggaaggtcaggctcggtgtctggctcacctgggtaggcatatggaggcgctggagattgctgcaaacttggaaaataaagcaaccaacacagaccatttaaccacggtactctacctccagcttgctatttgttcaagtttgcagaacttggagaaaacaattttctgcctgcagaaactgatttctttgcatccttttaatccttggaactggggcaaattggcagaggcttacctgaatctggggccagctctttcagcagcacttgcgtcatctcagaaacagcacagtttcacctcaagtgacaaaactatcaaatccttctttccacactcaggaaaagactgtcttttgtgttttcctgaaaccttgcctgagagctctttattttctgtggaagcgaatagcagtaatagccagaaaaatgagaaagctctgacaaatatccaaaactgtatggcagaaaagagagaaacagtgttgatagagactcagctgaaagcatgtgcctcttttatacgaaccaggcttctgcttcagtttacccaacctcagcaaacatcgtttgctttggagaggaacttaaggactcagcaggaaattgaagataaaatgaaagggttcagcttcaaagaagacactttgctgttgatagctgaggtgagtgtatccctcgggtttatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 49
- dehydrodolichyl diphosphate synthase
- chromosome 2 open reading frame 25
- mitochondrial ribosomal protein L15

Buy C8orf76-chromosome 8 open reading frame 76 Gene now

Add to cart