Login to display prices
Login to display prices
MRPL10-mitochondrial ribosomal protein L10 Gene View larger

MRPL10-mitochondrial ribosomal protein L10 Gene

PTXBC015904

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL10-mitochondrial ribosomal protein L10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL10-mitochondrial ribosomal protein L10 Gene

Proteogenix catalog: PTXBC015904
Ncbi symbol: MRPL10
Product name: MRPL10-mitochondrial ribosomal protein L10 Gene
Size: 2ug
Accessions: BC015904
Gene id: 124995
Gene description: mitochondrial ribosomal protein L10
Synonyms: L10MT; MRP-L10; MRP-L8; MRPL8; RPML8; 39S ribosomal protein L10, mitochondrial; 39S ribosomal protein L8, mitochondrial; L8mt; mitochondrial ribosomal protein L10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcggccgtggcggggatgctgcgagggggtctcctgccccaggcgggccggctgcctaccctccagactgtccgctatggctccaaggctgttacccgccaccgtcgtgtgatgcactttcagcggcagaagctgatggctgtgactgaatatatccccccgaaaccagccatccacccatcatgcctgccatctcctcccagccccccacaggaggagataggcctcatcaggcttctccgccgggagatagcagcagttttccaggacaaccgaatgatagccgtctgccagaatgtggctctgagtgcagaggacaagcttcttatgcgacaccagctgcggaaacacaagatcctgatgaagatcttccccaaccaggtcctgaagcccttcctggaggattccaagtaccaaaatctgctgcccctttttgtggggcacaacatgctgctggtcagtgaagagcccaaggtcaaggagatggtacggatcttaaggactgtgccattcctgccgctgctaggtggctgcattgatgacaccatcctcagcaggcagggctttatcaactactccaagctccccagcctgcccctggtgcagggggagcttgtaggaggcctcacctgcctcacagcccagacccactccctgctccagcaccagcccctccagctgaccaccctgttggaccagtacatcagagagcaacgcgagaaggattctgtcatgtcggccaatgggaagccagatcctgacactgttccggactcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: