MRPL10-mitochondrial ribosomal protein L10 Gene View larger

MRPL10-mitochondrial ribosomal protein L10 Gene

PTXBC015904

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL10-mitochondrial ribosomal protein L10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL10-mitochondrial ribosomal protein L10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015904
Product type: DNA & cDNA
Ncbi symbol: MRPL10
Origin species: Human
Product name: MRPL10-mitochondrial ribosomal protein L10 Gene
Size: 2ug
Accessions: BC015904
Gene id: 124995
Gene description: mitochondrial ribosomal protein L10
Synonyms: L10MT; MRP-L10; MRP-L8; MRPL8; RPML8; 39S ribosomal protein L10, mitochondrial; 39S ribosomal protein L8, mitochondrial; L8mt; mitochondrial ribosomal protein L10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcggccgtggcggggatgctgcgagggggtctcctgccccaggcgggccggctgcctaccctccagactgtccgctatggctccaaggctgttacccgccaccgtcgtgtgatgcactttcagcggcagaagctgatggctgtgactgaatatatccccccgaaaccagccatccacccatcatgcctgccatctcctcccagccccccacaggaggagataggcctcatcaggcttctccgccgggagatagcagcagttttccaggacaaccgaatgatagccgtctgccagaatgtggctctgagtgcagaggacaagcttcttatgcgacaccagctgcggaaacacaagatcctgatgaagatcttccccaaccaggtcctgaagcccttcctggaggattccaagtaccaaaatctgctgcccctttttgtggggcacaacatgctgctggtcagtgaagagcccaaggtcaaggagatggtacggatcttaaggactgtgccattcctgccgctgctaggtggctgcattgatgacaccatcctcagcaggcagggctttatcaactactccaagctccccagcctgcccctggtgcagggggagcttgtaggaggcctcacctgcctcacagcccagacccactccctgctccagcaccagcccctccagctgaccaccctgttggaccagtacatcagagagcaacgcgagaaggattctgtcatgtcggccaatgggaagccagatcctgacactgttccggactcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 24
- chromosome 1 open reading frame 71
- chromosome 1 open reading frame 35
- gap junction protein, beta 5, 31.1kDa

Buy MRPL10-mitochondrial ribosomal protein L10 Gene now

Add to cart