Login to display prices
Login to display prices
TINP1-TGF beta-inducible nuclear protein 1 Gene View larger

TINP1-TGF beta-inducible nuclear protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TINP1-TGF beta-inducible nuclear protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TINP1-TGF beta-inducible nuclear protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005288
Product type: DNA & cDNA
Ncbi symbol: TINP1
Origin species: Human
Product name: TINP1-TGF beta-inducible nuclear protein 1 Gene
Size: 2ug
Accessions: BC005288
Gene id: 10412
Gene description: TGF beta-inducible nuclear protein 1
Synonyms: TINP1; CDK105; HCL-G1; HCLG1; HUSSY-29; HUSSY29; ribosome biogenesis protein NSA2 homolog; TGF beta-inducible nuclear protein 1; TGF-beta inducible nuclear protein; hairy cell leukemia protein 1; NSA2, ribosome biogenesis homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccacagaatgaatatattgaattacaccgtaaacgctatggataccgtttggattaccatgagaaaaagagaaagaaggaaagtcgagaggctcatgaacgttcaaagaaggcaaagaaaatgattggtctgaaggctaagctttaccataaacagcgtcatgctgagaaaatacaaatgaaaaagactatcaagatgcatgaaaagagaaacaccaaacaaaagaatgatgaaaagacaccacagggagcagtacctgcctatctgctggacagagagggacaatctcgagctaaagtactttccaatatgattaaacagaaaagaaaagagaaggcgggaaaatgggaagtccctctgcctaaagtacgtgcccagggagaaacagaagtattaaaagttattcgaacaggaaagagaaagaagaaggcatggaagagaatggttactaaagtgtgctttgttggagatggctttacaagaaaaccacctaaatatgaaagattcatcaggccaatgggcttgcgtttcaagaaagcccatgtaacacatcctgaactgaaagccaccttttgcctaccaatacttggtgtaaagaagaatccctcatccccactgtatacaactttgggtgttattaccaaaggtactgtcattgaagtaaatgtgagcgaattgggccttgtgacacaaggaggcaaagttatttggggaaaatatgcccaggttaccaacaatcctgaaaatgatggatgtataaatgcagtcttactggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L10
- chromosome 9 open reading frame 24
- chromosome 1 open reading frame 71
- chromosome 1 open reading frame 35