C5orf44-chromosome 5 open reading frame 44 Gene View larger

C5orf44-chromosome 5 open reading frame 44 Gene

PTXBC012006

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf44-chromosome 5 open reading frame 44 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf44-chromosome 5 open reading frame 44 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012006
Product type: DNA & cDNA
Ncbi symbol: C5orf44
Origin species: Human
Product name: C5orf44-chromosome 5 open reading frame 44 Gene
Size: 2ug
Accessions: BC012006
Gene id: 80006
Gene description: chromosome 5 open reading frame 44
Synonyms: UPF0533 protein C5orf44; C5orf44; trafficking protein particle complex subunit 13; Trs65-related; trafficking protein particle complex 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagtgaatccccctaaacaggagcacctgctggcgctaaaagtgatgcggctgactaagcctactttattcaccaatatcccagtaacatgtgaagagaaagacttacctggagatctctttaaccagctgatgagagatgatccttcaaccgttaatggtgcagaagttttaatgttgggagaaatgctgactttaccacagaattttgggaatatatttttgggagagaccttttccagttatatcagcgttcataatgatagcaatcaagttgtaaaagacatattagtaaaagctgatcttcagacaagttctcagcgtttaaatctttcagcctccaatgctgcagtggctgaacttaaaccggattgttgtattgatgatgtcatacatcatgaagtcaaagaaattggaacacacatcttggtatgtgctgtgagttatacaactcaggctggagaaaaaatgtatttcagaaaattcttcaaatttcaggttctcaaaccattggatgtgaaaaccaaattttacaatgcagagagtgacctcagttctgtgactgatgaagtatttctggaagcccagattcagaataatgacaacctcacctatgtttatggagaaggtttcactggagccatctattatgtacaatgtaacagaattaaattcagtcagccaagctggagaatgtgtgtctacgtttgggtcaagagcatatttgcaaccaatggatacacgccagtacttatactgcctaaagccaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TGF beta-inducible nuclear protein 1
- mitochondrial ribosomal protein L10
- chromosome 9 open reading frame 24
- chromosome 1 open reading frame 71

Buy C5orf44-chromosome 5 open reading frame 44 Gene now

Add to cart