Login to display prices
Login to display prices
C5orf44-chromosome 5 open reading frame 44 Gene View larger

C5orf44-chromosome 5 open reading frame 44 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf44-chromosome 5 open reading frame 44 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf44-chromosome 5 open reading frame 44 Gene

Proteogenix catalog: PTXBC012006
Ncbi symbol: C5orf44
Product name: C5orf44-chromosome 5 open reading frame 44 Gene
Size: 2ug
Accessions: BC012006
Gene id: 80006
Gene description: chromosome 5 open reading frame 44
Synonyms: UPF0533 protein C5orf44; C5orf44; trafficking protein particle complex subunit 13; Trs65-related; trafficking protein particle complex 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagtgaatccccctaaacaggagcacctgctggcgctaaaagtgatgcggctgactaagcctactttattcaccaatatcccagtaacatgtgaagagaaagacttacctggagatctctttaaccagctgatgagagatgatccttcaaccgttaatggtgcagaagttttaatgttgggagaaatgctgactttaccacagaattttgggaatatatttttgggagagaccttttccagttatatcagcgttcataatgatagcaatcaagttgtaaaagacatattagtaaaagctgatcttcagacaagttctcagcgtttaaatctttcagcctccaatgctgcagtggctgaacttaaaccggattgttgtattgatgatgtcatacatcatgaagtcaaagaaattggaacacacatcttggtatgtgctgtgagttatacaactcaggctggagaaaaaatgtatttcagaaaattcttcaaatttcaggttctcaaaccattggatgtgaaaaccaaattttacaatgcagagagtgacctcagttctgtgactgatgaagtatttctggaagcccagattcagaataatgacaacctcacctatgtttatggagaaggtttcactggagccatctattatgtacaatgtaacagaattaaattcagtcagccaagctggagaatgtgtgtctacgtttgggtcaagagcatatttgcaaccaatggatacacgccagtacttatactgcctaaagccaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: