Login to display prices
Login to display prices
NIP30-NEFA-interacting nuclear protein NIP30 Gene View larger

NIP30-NEFA-interacting nuclear protein NIP30 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIP30-NEFA-interacting nuclear protein NIP30 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NIP30-NEFA-interacting nuclear protein NIP30 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020536
Product type: DNA & cDNA
Ncbi symbol: NIP30
Origin species: Human
Product name: NIP30-NEFA-interacting nuclear protein NIP30 Gene
Size: 2ug
Accessions: BC020536
Gene id: 80011
Gene description: NEFA-interacting nuclear protein NIP30
Synonyms: NEFA-interacting nuclear protein NIP30; NIP30; C16orf94; CDA018; CDA10; protein FAM192A; family with sequence similarity 192 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggaggggatgatggtaaccttattatcaaaaagaggtttgtgtctgaggcagaactagatgaacggcgcaaaaggaggcaagaagaatgggagaaagttcgaaaacctgaagatccagaagaatgtccagaggaggtttatgaccctcgatctctatatgaaaggctacaggaacagaaggacaggaagcagcaggagtacgaggaacagttcaaattcaaaaacatggtaagaggcttagatgaagatgagaccaacttccttgatgaggtttctcgacagcaggaactaatagaaaagcaacgaagagaagaagaactgaaagaactgaaggaatacagaaataacctcaagaaggttggaatttctcaagagaacaagaaggaagtggaaaagaaactgactgtgaagcctatagaaaccaagaacaagttctcccaggcgaagctgttggcaggagctgtgaagcataagagctcagagagtggcaacagtgtgaaaagactgaaaccggaccctgagccagatgacaagaatcaagagccctcatcctgcaagtctctcggaaacacctccctgagtggcccctccatccactgcccctctgctgcagtatgtatcggcatcctcccaggcctgggtgcctactctgggagcagcgactccgagtccagctcagacagcgaaggcaccatcaatgccaccggaaagattgtctcctccatcttccgaaccaacaccttcctcgaggccccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 53
- chromosome 18 open reading frame 24
- chromosome 20 open reading frame 39
- mitochondrial ribosome recycling factor