C20orf39-chromosome 20 open reading frame 39 Gene View larger

C20orf39-chromosome 20 open reading frame 39 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf39-chromosome 20 open reading frame 39 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf39-chromosome 20 open reading frame 39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030637
Product type: DNA & cDNA
Ncbi symbol: C20orf39
Origin species: Human
Product name: C20orf39-chromosome 20 open reading frame 39 Gene
Size: 2ug
Accessions: BC030637
Gene id: 79953
Gene description: chromosome 20 open reading frame 39
Synonyms: C20orf39; DSPC2; IFITMD5; TMEM90B; synapse differentiation-inducing gene protein 1; dispanin subfamily C member 2; interferon induced transmembrane protein domain containing 5; synapse differentiation induced gene 1; transmembrane protein 90B; synapse differentiation inducing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggcatcattgaacagaagagcatgctggtgcacagtaaaatcagtgatgctggcaagaggaatggtttaattaacaccagaaacttgatggccgagagcagagatggtctggtgtctgtttacccagcgccccagtaccagagccaccgggtgggggccagcacagtgccggccagcctggacagcagcaggagtgagccgatgcagcagctgctggaccccaacaccctgcagcagtcagtggagtcccgctaccggcccaacatcatcctctattcagagggcgtgctgcgctcctggggggacggtgtggccgccgactgctgcgagacaaccttcatcgaggaccggtcgcccaccaaagacagcctcgagtacccggatgggaagttcattgacctctcagctgatgacataaaaatccacaccctgtcctacgatgtggaggaggaggaggagttccaggagctggagagcgactactcaagcgacacagagagtgaggacaatttcctcatgatgcccccgcgggaccacctgggcctcagtgtcttctccatgctctgctgcttctggcctctgggcatcgcagccttctacttgtcccatgagaccaacaaagccgtggccaagggggacttgcaccaggccagcaccagctcccggcgggccctattcctggcagtgctgtccatcaccattgggactggcgtctatgtgggcgtggccgtggccctcatcgcctacctctccaagaacaaccacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosome recycling factor
- chromosome 16 open reading frame 57
- chromosome 11 open reading frame 54
- chromosome 16 open reading frame 78

Buy C20orf39-chromosome 20 open reading frame 39 Gene now

Add to cart