MRRF-mitochondrial ribosome recycling factor Gene View larger

MRRF-mitochondrial ribosome recycling factor Gene

PTXBC013049

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRRF-mitochondrial ribosome recycling factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRRF-mitochondrial ribosome recycling factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013049
Product type: DNA & cDNA
Ncbi symbol: MRRF
Origin species: Human
Product name: MRRF-mitochondrial ribosome recycling factor Gene
Size: 2ug
Accessions: BC013049
Gene id: 92399
Gene description: mitochondrial ribosome recycling factor
Synonyms: MRFF; MTRRF; RRF; ribosome-recycling factor, mitochondrial; ribosome-releasing factor, mitochondrial; mitochondrial ribosome recycling factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttgggattaaagtgcttccgcatggtccaccctacctttcgcaattatcttgcagcctctatcagacccgtttcagaagttacactgaagacagtgcatgaaagacaacatggccataggcaatacatggcctattcagctgtaccagtccgccattttgctaccaagaaagccaaagccaaagggaaaggacagtcccaaaccagagtgaatattaatgctgccttggttgaggatataatcaacttggaagaggtgaatgaagaaatgaagtctgtgatagaagctctcaaggataatttcaataagactctcaatataaggacctcaccaggatcccttgacaagattgctgtggtaactgctgacgggaagcttgctttaaaccagattagccagatctccatgaagtcgccacagctgattttggtgaatatggccagcttcccagagtgtacagctgcagctatcaaggctataagagaaagtggaatgaatctgaacccagaagtggaagggacgctaattcgggtacccattccccaagtaaccagagagcacagagaaatgctggtgaaactggccaaacagaacaccaacaaggccaaagactctttacggaaggttcgcaccaactcaatgaacaagctgaagaaatccaaggatacagtctcagaggacaccattaggctaatagagaaacagatcagccaaatggccgatgacacagtggcagaactggacaggcatctggcagtgaagaccaaagaactccttggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 57
- chromosome 11 open reading frame 54
- chromosome 16 open reading frame 78
- chromosome 21 open reading frame 33

Buy MRRF-mitochondrial ribosome recycling factor Gene now

Add to cart