C16orf53-chromosome 16 open reading frame 53 Gene View larger

C16orf53-chromosome 16 open reading frame 53 Gene

PTXBC003640

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf53-chromosome 16 open reading frame 53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf53-chromosome 16 open reading frame 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003640
Product type: DNA & cDNA
Ncbi symbol: C16orf53
Origin species: Human
Product name: C16orf53-chromosome 16 open reading frame 53 Gene
Size: 2ug
Accessions: BC003640
Gene id: 79447
Gene description: chromosome 16 open reading frame 53
Synonyms: C16orf53; GAS; PA1; PAXIP1-associated glutamate-rich protein 1; PAXIP1-associated protein 1; PTIP-associated 1 protein; PTIP-associated protein 1; glutamate-rich coactivator associated with SRC1; glutamate-rich coactivator interacting with SRC1; glutamate-rich coactivator interacting with SRC1/NCOA1; PAXIP1 associated glutamate rich protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccttgctcggggccatggagacactgcggccagtacggcggcgcctctgtctgaagaaggggaagtgacctccggcctccaggctctggccgtggaggataccggaggcccctctgcctcggccggtaaggccgaggacgagggggaaggaggccgagaggagaccgagcgtgaggggtccgggggcgaggaggcgcagggagaagtccccagcgctgggggagaagagcctgccgaggaggactccgaggactggtgcgtgccctgcagcgacgaggaggtggagctgcctgcggatgggcagccctggatgcccccgccctccgaaatccagcggctctatgaactgctggctgcccacggtactctggagctgcaagccgagatcctgccccgccggcctcccacgccggaggcccagagcgaagaggagagatccgatgaggagccggaggccaaagaagaggaagaggaaaaaccacacatgcccacggaatttgattttgatgatgagccagtgacaccaaaggactccctgattgaccggagacgcaccccaggaagctcagcccggagccagaaacgggaggcccgcctggacaaggtgctgtcggacatgaagagacacaagaagctggaggagcagatccttcgtaccgggagggacctcttcagcctggactcggaggaccccagccccgccagccccccactccgatcctccgggagtagtctcttccctcggcagcggaaatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 24
- chromosome 20 open reading frame 39
- mitochondrial ribosome recycling factor
- chromosome 16 open reading frame 57

Buy C16orf53-chromosome 16 open reading frame 53 Gene now

Add to cart