Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C16orf53-chromosome 16 open reading frame 53 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C16orf53-chromosome 16 open reading frame 53 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003640 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C16orf53 |
| Origin species: | Human |
| Product name: | C16orf53-chromosome 16 open reading frame 53 Gene |
| Size: | 2ug |
| Accessions: | BC003640 |
| Gene id: | 79447 |
| Gene description: | chromosome 16 open reading frame 53 |
| Synonyms: | C16orf53; GAS; PA1; PAXIP1-associated glutamate-rich protein 1; PAXIP1-associated protein 1; PTIP-associated 1 protein; PTIP-associated protein 1; glutamate-rich coactivator associated with SRC1; glutamate-rich coactivator interacting with SRC1; glutamate-rich coactivator interacting with SRC1/NCOA1; PAXIP1 associated glutamate rich protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccttgctcggggccatggagacactgcggccagtacggcggcgcctctgtctgaagaaggggaagtgacctccggcctccaggctctggccgtggaggataccggaggcccctctgcctcggccggtaaggccgaggacgagggggaaggaggccgagaggagaccgagcgtgaggggtccgggggcgaggaggcgcagggagaagtccccagcgctgggggagaagagcctgccgaggaggactccgaggactggtgcgtgccctgcagcgacgaggaggtggagctgcctgcggatgggcagccctggatgcccccgccctccgaaatccagcggctctatgaactgctggctgcccacggtactctggagctgcaagccgagatcctgccccgccggcctcccacgccggaggcccagagcgaagaggagagatccgatgaggagccggaggccaaagaagaggaagaggaaaaaccacacatgcccacggaatttgattttgatgatgagccagtgacaccaaaggactccctgattgaccggagacgcaccccaggaagctcagcccggagccagaaacgggaggcccgcctggacaaggtgctgtcggacatgaagagacacaagaagctggaggagcagatccttcgtaccgggagggacctcttcagcctggactcggaggaccccagccccgccagccccccactccgatcctccgggagtagtctcttccctcggcagcggaaatactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 18 open reading frame 24 - chromosome 20 open reading frame 39 - mitochondrial ribosome recycling factor - chromosome 16 open reading frame 57 |