C18orf24-chromosome 18 open reading frame 24 Gene View larger

C18orf24-chromosome 18 open reading frame 24 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf24-chromosome 18 open reading frame 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf24-chromosome 18 open reading frame 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015706
Product type: DNA & cDNA
Ncbi symbol: C18orf24
Origin species: Human
Product name: C18orf24-chromosome 18 open reading frame 24 Gene
Size: 2ug
Accessions: BC015706
Gene id: 220134
Gene description: chromosome 18 open reading frame 24
Synonyms: C18orf24; spindle and kinetochore-associated protein 1; spindle and KT (kinetochore) associated 1; spindle and kinetochore associated complex subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctcgtcagatctggaacaattatgctctcatgttaatgaaaagattggcaatattaagaaaaccttatcattaagaaactgtggccaggaacctaccttgaaaactgtattaaataaaataggagatgagatcattgtaataaatgaacttctaaataaattggaattggaaattcagtatcaagaacaaaccaacaattcactcaaggaactctgtgaatctcttgaagaagattacaaagacatagaacatcttaaagaaaacgttccttcccatttgcctcaagtaacagtaacccagagctgtgttaagggatcagatcttgatcctgaagaaccaatcaaagttgaagaacctgaacccgtaaagaagcctcccaaagagcaaagaagtattaaggaaatgccatttataacttgtgatgagttcaatggtgttccttcgtacatgaaatcccgcttaacctataatcaaattaatgatgttattaaagaaatcaacaaggcagtaattagtaaatataaaatcctacatcagccaaaaaagtctatgaattctgtgaccagaaatctctatcacagatttattgatgaagaaacgaaggataccaaaggtcgttattttatagtggaagctgacataaaggagttcacaactttgaaagctgacaagaagtttcacgtgttactgaatattttacgacactgccggaggctatcagaggtccgagggggaggacttactcgttatgttataacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 39
- mitochondrial ribosome recycling factor
- chromosome 16 open reading frame 57
- chromosome 11 open reading frame 54

Buy C18orf24-chromosome 18 open reading frame 24 Gene now

Add to cart