SLC25A41-solute carrier family 25, member 41 Gene View larger

SLC25A41-solute carrier family 25, member 41 Gene

PTXBC031671

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A41-solute carrier family 25, member 41 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A41-solute carrier family 25, member 41 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031671
Product type: DNA & cDNA
Ncbi symbol: SLC25A41
Origin species: Human
Product name: SLC25A41-solute carrier family 25, member 41 Gene
Size: 2ug
Accessions: BC031671
Gene id: 284427
Gene description: solute carrier family 25, member 41
Synonyms: APC4; solute carrier family 25 member 41
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggtctactcctccaagacgaacttcaccaacctgctgggggggctacagagcatggtccaggagggcggcttccgctccctgtggcggggcaacggcatcaacgtgctcaagattgctcctgagtatgccatcaagttctccgtattcgagcagtgcaagaattacttctgtggaatacaagggtccccgcccttccaggagcgtctccttgctggctccctggctgtggccatctcccagaccctcatcaaccccatggaggtgctgaagacgcggttgaccttgcgtcggacgggccagtacaaggggctgctggactgcgccaggcagatcttgcagcgagagggcacccgcgccctttaccgcggctacctgcccaatatgctcggcatcatcccctatgcctgcaccgacctggctgtctatgagatgctccagtgcttctgggtgaagtcaggcagggatatgggggaccccagtggcctggtcagtctgtcgtctgtgacgctatccacgacctgtggccagatggccagctacccactgactctggtgcgcaccaggatgcaggcccaagataccgtggagggctcaaatcccaccatgcgcggagtcctccagcggatcctggcccagcagggctggctagggctgtaccgaggcatgacccccacgctactgaaggtcttaccagcaggtggcatcagctatgtggtgtacgaagccatgaagaaaaccctgggcatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NEFA-interacting nuclear protein NIP30
- chromosome 16 open reading frame 53
- chromosome 18 open reading frame 24
- chromosome 20 open reading frame 39

Buy SLC25A41-solute carrier family 25, member 41 Gene now

Add to cart