C18orf55-chromosome 18 open reading frame 55 Gene View larger

C18orf55-chromosome 18 open reading frame 55 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf55-chromosome 18 open reading frame 55 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf55-chromosome 18 open reading frame 55 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000892
Product type: DNA & cDNA
Ncbi symbol: C18orf55
Origin species: Human
Product name: C18orf55-chromosome 18 open reading frame 55 Gene
Size: 2ug
Accessions: BC000892
Gene id: 29090
Gene description: chromosome 18 open reading frame 55
Synonyms: C18orf55; HSPC154; TIM21; mitochondrial import inner membrane translocase subunit Tim21; TIM21-like protein, mitochondrial; translocase of inner mitochondrial membrane 21 homolog; translocase of inner mitochondrial membrane 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatttgtacttttctacgagccgtacagtatacggagaagctgcacaggtcctcggcaaagcgattgcttttgccatacatcgtgcttaacaaagcgtgcttgaagactgagcccagtttgagatgtgggcttcaatatcaaaagaaaacgctgcgacctagatgtattcttggagtcacccagaaaaccatctggacgcagggaccgagcccccgaaaagcaaaggaggatggcagcaaacaagtgtctgtgcacaggagtcagagagggggaaccgccgtcccaacatcacaaaaagtgaaagaagccggaagagattttacctatttaatagtggtgctttttggaatcagcattacaggtggcttgttttacacgattttcaaagaacttttttcttcatccagtcctagcaagatatatgggagagccttagaaaaatgcagatcacatcctgaggtgatcggtgtctttggtgagtctgttaaaggctatggggaggtgacaaggcggggtcgccggcagcatgtcaggttcactgaatatgtaaaagatgggctgaaacacacgtgtgtgaaattctacattgagggctctgagccagggaagcaaggaacggtgtatgcgcaagtgaaagagaacccaggaagtggtgaatatgattttcgatatatatttgtagaaattgaatcttatcctagaagaactattatcattgaagataatcgatcccaagatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 41
- NEFA-interacting nuclear protein NIP30
- chromosome 16 open reading frame 53
- chromosome 18 open reading frame 24

Buy C18orf55-chromosome 18 open reading frame 55 Gene now

Add to cart