Login to display prices
Login to display prices
C14orf80-chromosome 14 open reading frame 80 Gene View larger

C14orf80-chromosome 14 open reading frame 80 Gene

PTXBC016028

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf80-chromosome 14 open reading frame 80 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf80-chromosome 14 open reading frame 80 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016028
Product type: DNA & cDNA
Ncbi symbol: C14orf80
Origin species: Human
Product name: C14orf80-chromosome 14 open reading frame 80 Gene
Size: 2ug
Accessions: BC016028
Gene id: 283643
Gene description: chromosome 14 open reading frame 80
Synonyms: chromosome 8 open reading frame, human C14orf80; C8H14orf80
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcccaggcccgagtgcctctgggtgacgagatgactgtgtgccagatccacctgtacacacgcggctgccacagcgaccagagccttagccatctgtctgtcactgaagcagagatgctcagggacccagagggaggccagcagctgctgcggactctggagcgtgagaaccagcgcctggaggctgtcctggcgtggcggcgctctgagctggtcttctggcggtggatggacacggtcctgggcacctgtgccccggaggtgcctgctgcagcctcacagcccaccttcctgccctgggtccccgagcgcgggggtggcgagttggacctggtagtgcgggagctgcaggcactggaggaggagctgcgggaggctgcggagcgcaggcgggcggcctgggaggccaaggctggaggctgtggacgggggccagagtggagtgccgcgcggcgggcctctcgggaggctgtggaaaaggagctgggagctctacagcagtgctgggagcgagacggtggcccggcccagccccatgggccacaccggctggtgagacgagaggatggggcagcaggggaccgggacctgcgggcagctgtggtgatcaggacgctgaggagccaggaggcctgcctggaggcggtgctacgtcgactacagggacagtgtcggcaggaactggccaggctggtgggagcccgccctggtctcatctggatcccgccacctggacgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 55
- solute carrier family 25, member 41
- NEFA-interacting nuclear protein NIP30
- chromosome 16 open reading frame 53