C20orf12-chromosome 20 open reading frame 12 Gene View larger

C20orf12-chromosome 20 open reading frame 12 Gene

PTXBC036231

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf12-chromosome 20 open reading frame 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf12-chromosome 20 open reading frame 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036231
Product type: DNA & cDNA
Ncbi symbol: C20orf12
Origin species: Human
Product name: C20orf12-chromosome 20 open reading frame 12 Gene
Size: 2ug
Accessions: BC036231
Gene id: 55184
Gene description: chromosome 20 open reading frame 12
Synonyms: ankyrin repeat-containing protein C20orf12; C20orf12; ANKRD64; C20orf84; bA189K21.1; bA189K21.8; dJ568F9.2; double zinc ribbon and ankyrin repeat-containing protein 1; ankyrin repeat domain 64; double zinc ribbon and ankyrin repeat domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgctggttcagtgtgtgtccctcagatcataccactacgagtgcctcagcctggaaaagctaaccatgaaattgataacaatacgcttttggaaatgaaatcagacactccagatgtcaacatatattatactctggatggcagcaaacctgaatttctaaagagaattggttatggggaaaataacacatttaagtatataaaacctattactctgcctgatggaaaaatacaagttaaagctattgctgtctctaaagactgcagacagagtggcattgcgacaaaggtgtttcacgtagactatgaaccaccaaatatagtctctcctgaagacaatgttgaaaatgttctcaaagattcttcaaggcaggaattcaaaaatggatttgttggatcaaaactaaagaaaaaatataagaactctgaaaatcaacgcagctggaatgttaaccttagaaagtttccagtcccccggttttgcacacgtaagcggtcagaagtgtttgacaagcacggagataatgagaattcaaagggagacagactttctcaagtgtgcccactgccttgccccccggccatcagatccctttgctcgcttctgtcaagaatgtggctctcctgtcccacccatatttggctgtcgtctcccacccccagaaggagctcagatgggcttgtgtgcagaatgcagaagcttggtacccatgaacactcccatctgcgtggtgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 80
- chromosome 18 open reading frame 55
- solute carrier family 25, member 41
- NEFA-interacting nuclear protein NIP30

Buy C20orf12-chromosome 20 open reading frame 12 Gene now

Add to cart