PTXBC036231
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036231 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C20orf12 |
| Origin species: | Human |
| Product name: | C20orf12-chromosome 20 open reading frame 12 Gene |
| Size: | 2ug |
| Accessions: | BC036231 |
| Gene id: | 55184 |
| Gene description: | chromosome 20 open reading frame 12 |
| Synonyms: | ankyrin repeat-containing protein C20orf12; C20orf12; ANKRD64; C20orf84; bA189K21.1; bA189K21.8; dJ568F9.2; double zinc ribbon and ankyrin repeat-containing protein 1; ankyrin repeat domain 64; double zinc ribbon and ankyrin repeat domains 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgctggttcagtgtgtgtccctcagatcataccactacgagtgcctcagcctggaaaagctaaccatgaaattgataacaatacgcttttggaaatgaaatcagacactccagatgtcaacatatattatactctggatggcagcaaacctgaatttctaaagagaattggttatggggaaaataacacatttaagtatataaaacctattactctgcctgatggaaaaatacaagttaaagctattgctgtctctaaagactgcagacagagtggcattgcgacaaaggtgtttcacgtagactatgaaccaccaaatatagtctctcctgaagacaatgttgaaaatgttctcaaagattcttcaaggcaggaattcaaaaatggatttgttggatcaaaactaaagaaaaaatataagaactctgaaaatcaacgcagctggaatgttaaccttagaaagtttccagtcccccggttttgcacacgtaagcggtcagaagtgtttgacaagcacggagataatgagaattcaaagggagacagactttctcaagtgtgcccactgccttgccccccggccatcagatccctttgctcgcttctgtcaagaatgtggctctcctgtcccacccatatttggctgtcgtctcccacccccagaaggagctcagatgggcttgtgtgcagaatgcagaagcttggtacccatgaacactcccatctgcgtggtgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 14 open reading frame 80 - chromosome 18 open reading frame 55 - solute carrier family 25, member 41 - NEFA-interacting nuclear protein NIP30 |