Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C1orf124-chromosome 1 open reading frame 124 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1orf124-chromosome 1 open reading frame 124 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015740 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1orf124 |
| Origin species: | Human |
| Product name: | C1orf124-chromosome 1 open reading frame 124 Gene |
| Size: | 2ug |
| Accessions: | BC015740 |
| Gene id: | 83932 |
| Gene description: | chromosome 1 open reading frame 124 |
| Synonyms: | C1orf124; DVC1; PRO4323; spartan; sprT-like domain-containing protein Spartan; DNA damage protein targeting VCP; DNA damage-targeting VCP (p97) adaptor; zinc finger RAD18 domain-containing protein; SprT-like N-terminal domain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgatgacttgatgttggcactgcggcttcaggaggagtggaacttgcaggaggcggagcgcgatcatgcccaggagtccctgtcgctagtggacgcgtcgtgggagttggtggaccccacaccggacttgcaggcactgtttgttcagtttaacgaccaattcttctggggccagctggaggccgtcgaggtgaagtggagcgtgcgaatgaccctgtgtgctgggatatgcagctatgaagggaagggtggaatgtgttccatccgtctcagcgaaccccttttgaagttgaggccaagaaaggatcttgtagagaccctcctgcatgaaatgatacatgcctatttatttgtcactaataacgacaaagaccgagaagggcatggtccagaattttgtaaacatatgcatcgcatcaacagcctgactggagccaatataacggtataccatacttttcacgatgaggtggatgagtatcggcgacactggtggcgctgcaatgggccgtgccagcacaggccaccgtattacggctatgtcaaacgagctactaacagggaaccctctgctcatgactattggtgggctgagcaccagaaaacctgtggaggcacttacataaaaatcaaggaaccagagaattactcaaaaaaaggcaaaggaaaggcaaaactaggaaaggaaccagtattggccgcagagaataaaggtaccttcgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 20 open reading frame 12 - chromosome 14 open reading frame 80 - chromosome 18 open reading frame 55 - solute carrier family 25, member 41 |