Cart 2 Product Products 508,40 € (empty)
-
-
1 x LOC285074-...113,40 €
No products
To be determined Shipping
508,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 508,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 508,40 €
View larger 
Data sheet of NRIP3-nuclear receptor interacting protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NRIP3-nuclear receptor interacting protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008835 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NRIP3 |
| Origin species: | Human |
| Product name: | NRIP3-nuclear receptor interacting protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC008835 |
| Gene id: | 56675 |
| Gene description: | nuclear receptor interacting protein 3 |
| Synonyms: | C11orf14; NY-SAR-105; nuclear receptor-interacting protein 3; sarcoma antigen NY-SAR-105; nuclear receptor interacting protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttttactcagggctcctcactgagggcggccgcaaggagaccgacatgcgggaggcggcgtcactgcgacagcagcgccggatgaagcaggcggtgcagttcatccacaaggactccgccgacctgctgcccctggacggcctcaagaagctgggctcgtccaaggacatgcaacctcataatattctgcagaggcgcctcatggaaaccaacctgtctaagctccgaagcggtccccgtgtcccttgggcctctaagacgaacaaactcaatcaggctaagtctgaggggctaaagaagtctgaggaggatgacatgattttggtttcttgccagtgtgctggaaaggatgtgaaagccttggttgacacaggctgcctatataatctcatctctttggcctgtgtggacagattgggactcaaggagcatgtcaaatcccacaagcatgaaggagaaaagctttctctaccccggcatctcaaagtagtgggccagattgagcacctagtgatcacactgggctccctccgcctggactgcccagcagctgtggttgatgacaatgagaaaaacttgtcccttggtctacagactctccgatctctgaagtgcatcataaacttggataagcaccggctgatcatggggaagacagacaaggaagaaatcccttttgtggagacagtctctttgaatgaagacaacacttcagaagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 124 - chromosome 20 open reading frame 12 - chromosome 14 open reading frame 80 - chromosome 18 open reading frame 55 |