Login to display prices
Login to display prices
NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene View larger

NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene

PTXBC012626

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene

Proteogenix catalog: PTXBC012626
Ncbi symbol: NAT8
Product name: NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene
Size: 2ug
Accessions: BC012626
Gene id: 9027
Gene description: N-acetyltransferase 8 (GCN5-related, putative)
Synonyms: ATase2; CCNAT; CML1; GLA; Hcml1; TSC501; TSC510; N-acetyltransferase 8; N-acetyltransferase 8 (GCN5-related, putative); N-acetyltransferase 8 (camello like); acetyltransferase 2; camello-like protein 1; cysteinyl-conjugate N-acetyltransferase; kidney- and liver-specific gene product; N-acetyltransferase 8 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccttgtcacatccgcaaataccaggagagcgaccgccagtgggttgtgggcttgctctcccgggggatggccgagcatgccccagccaccttccggcaattgctgaagctgcctcgaaccctcatactcttacttggggggcccctcgccctactcctggtctctggatcctggcttctagccctcgtgttcagcatcagcctcttccctgccctgtggttccttgccaaaaaaccctggacggagtatgtggacatgacattgtgcacagacatgtctgacattaccaaatcctacctgagtgagcgtggctcctgcttctgggtggctgagtctgaagagaaggtggtgggcatggtaggagctctgcctgttgatgatcccaccttgagggagaagcggttgcagctgtttcatctctttgtggacagtgagcaccgtcgtcaggggatagcaaaagccctggtcaggactgtcctccagtttgcccgggaccagggctacagtgaagttatcctggacaccggcaccatccagctctctgctatggccctctaccagagcatgggcttcaagaagacgggccagtccttcttctgtgtgtgggccaggctagtggctcttcatacagttcatttcatctaccacctcccttcttctaaggtagggagtcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: