Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012626 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAT8 |
| Origin species: | Human |
| Product name: | NAT8-N-acetyltransferase 8 (GCN5-related, putative) Gene |
| Size: | 2ug |
| Accessions: | BC012626 |
| Gene id: | 9027 |
| Gene description: | N-acetyltransferase 8 (GCN5-related, putative) |
| Synonyms: | ATase2; CCNAT; CML1; GLA; Hcml1; TSC501; TSC510; N-acetyltransferase 8; N-acetyltransferase 8 (GCN5-related, putative); N-acetyltransferase 8 (camello like); acetyltransferase 2; camello-like protein 1; cysteinyl-conjugate N-acetyltransferase; kidney- and liver-specific gene product; N-acetyltransferase 8 (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctccttgtcacatccgcaaataccaggagagcgaccgccagtgggttgtgggcttgctctcccgggggatggccgagcatgccccagccaccttccggcaattgctgaagctgcctcgaaccctcatactcttacttggggggcccctcgccctactcctggtctctggatcctggcttctagccctcgtgttcagcatcagcctcttccctgccctgtggttccttgccaaaaaaccctggacggagtatgtggacatgacattgtgcacagacatgtctgacattaccaaatcctacctgagtgagcgtggctcctgcttctgggtggctgagtctgaagagaaggtggtgggcatggtaggagctctgcctgttgatgatcccaccttgagggagaagcggttgcagctgtttcatctctttgtggacagtgagcaccgtcgtcaggggatagcaaaagccctggtcaggactgtcctccagtttgcccgggaccagggctacagtgaagttatcctggacaccggcaccatccagctctctgctatggccctctaccagagcatgggcttcaagaagacgggccagtccttcttctgtgtgtgggccaggctagtggctcttcatacagttcatttcatctaccacctcccttcttctaaggtagggagtcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inverted formin, FH2 and WH2 domain containing - Kv channel interacting protein 3, calsenilin - dehydrogenase/reductase (SDR family) member 2 - tubulin tyrosine ligase-like family, member 5 |