Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of INF2-inverted formin, FH2 and WH2 domain containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INF2-inverted formin, FH2 and WH2 domain containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006173 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INF2 |
| Origin species: | Human |
| Product name: | INF2-inverted formin, FH2 and WH2 domain containing Gene |
| Size: | 2ug |
| Accessions: | BC006173 |
| Gene id: | 64423 |
| Gene description: | inverted formin, FH2 and WH2 domain containing |
| Synonyms: | C14orf151; C14orf173; CMTDIE; FSGS5; pp9484; inverted formin-2; HBEAG-binding protein 2 binding protein C; HBEBP2-binding protein C; inverted formin, FH2 and WH2 domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggtgaaggagggcgcacagcgcaagtgggcagcgctgaaggagaagctggggccacaggattcggaccccacggaggccaacctggagagcgcggaccctgagctgtgcatccggctgctccagatgccctctgtggtcaactactccggcctgcgcaagcgcctggagggcagcgacggcggctggatggtgcagttcctggagcagagcggcctggacctgctgctggaggcgctggcgcggctgtcgggccgcggcgttgcacgtatctccgacgccctgctgcagctcacctgcgtcagctgcgtgcgcgccgtcatgaactcgcggcagggcatcgagtacatcctcagcaaccagggctacgtgcgccagctctcccaggccctggacacatccaacgtgatggtgaagaagcaggtgtttgagctactggctgccctgtgcatctactctcccgagggccacgtgctgaccctggacgccctggaccactacaagacggtgtgcagccagcagtaccgcttcagcattgtcatgaacgagctctccggcagcgacaacgtgccctacgtggtcaccctgcttagcgtgatcaacgccgtcatcttgggccccgaggacctgcgcgcgcgcacccagctgcggaacgagtttatcgggctgcagctgctggacgtcctggctcgcctgcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Kv channel interacting protein 3, calsenilin - dehydrogenase/reductase (SDR family) member 2 - tubulin tyrosine ligase-like family, member 5 - insulin-like growth factor binding protein 5 |