Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of KCNIP3-Kv channel interacting protein 3, calsenilin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNIP3-Kv channel interacting protein 3, calsenilin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012850 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNIP3 |
| Origin species: | Human |
| Product name: | KCNIP3-Kv channel interacting protein 3, calsenilin Gene |
| Size: | 2ug |
| Accessions: | BC012850 |
| Gene id: | 30818 |
| Gene description: | Kv channel interacting protein 3, calsenilin |
| Synonyms: | CSEN; DREAM; KCHIP3; calsenilin; A-type potassium channel modulatory protein 3; DRE-antagonist modulator; Kv channel interacting protein 3; Kv channel interacting protein 3, calsenilin; calsenilin, presenilin-binding protein, EF hand transcription factor; kv channel-interacting protein 3; potassium channel interacting protein 3; potassium voltage-gated channel interacting protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagccggctaaggaagtgacaaaggcgtcggacggcagcctcctgggggacctcgggcacacaccacttagcaagaaggagggtatcaagtggcagaggccgaggctcagccgccaggctttgatgagatgctgcctggtcaagtggatcctgtccagcacagccccacagggctcagatagcagcgacagtgagctggagctgtccacggtgcgccaccagccagaggggctggaccagctgcaggcccagaccaagttcaccaagaaggagctgcagtctctctacaggggctttaagaatgagtgtcccacgggcctggtggacgaagacaccttcaaactcatttacgcgcagttcttccctcagggagatgccaccacctatgcacacttcctcttcaacgcctttgatgcggacgggaacggggccatccactttgaggactttgtggttggcctctccatcctgctgcggggcacagtccacgagaagctcaagtgggcctttaatctctacgacattaacaaggatggctacatcaccaaagaggagatgctggccatcatgaagtccatctatgacatgatgggccgccacacctaccccatcctgcgggaggacgcgccggcggagcacgtggagaggttcttcgagaaaatggaccggaaccaggatggggtagtgaccattgaagagttcctggaggcctgtcagaaggatgagaacatcatgagctccatgcagctgtttgagaatgtcatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dehydrogenase/reductase (SDR family) member 2 - tubulin tyrosine ligase-like family, member 5 - insulin-like growth factor binding protein 5 - family with sequence similarity 44, member A |