KCNIP3-Kv channel interacting protein 3, calsenilin Gene View larger

KCNIP3-Kv channel interacting protein 3, calsenilin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNIP3-Kv channel interacting protein 3, calsenilin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNIP3-Kv channel interacting protein 3, calsenilin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012850
Product type: DNA & cDNA
Ncbi symbol: KCNIP3
Origin species: Human
Product name: KCNIP3-Kv channel interacting protein 3, calsenilin Gene
Size: 2ug
Accessions: BC012850
Gene id: 30818
Gene description: Kv channel interacting protein 3, calsenilin
Synonyms: CSEN; DREAM; KCHIP3; calsenilin; A-type potassium channel modulatory protein 3; DRE-antagonist modulator; Kv channel interacting protein 3; Kv channel interacting protein 3, calsenilin; calsenilin, presenilin-binding protein, EF hand transcription factor; kv channel-interacting protein 3; potassium channel interacting protein 3; potassium voltage-gated channel interacting protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccggctaaggaagtgacaaaggcgtcggacggcagcctcctgggggacctcgggcacacaccacttagcaagaaggagggtatcaagtggcagaggccgaggctcagccgccaggctttgatgagatgctgcctggtcaagtggatcctgtccagcacagccccacagggctcagatagcagcgacagtgagctggagctgtccacggtgcgccaccagccagaggggctggaccagctgcaggcccagaccaagttcaccaagaaggagctgcagtctctctacaggggctttaagaatgagtgtcccacgggcctggtggacgaagacaccttcaaactcatttacgcgcagttcttccctcagggagatgccaccacctatgcacacttcctcttcaacgcctttgatgcggacgggaacggggccatccactttgaggactttgtggttggcctctccatcctgctgcggggcacagtccacgagaagctcaagtgggcctttaatctctacgacattaacaaggatggctacatcaccaaagaggagatgctggccatcatgaagtccatctatgacatgatgggccgccacacctaccccatcctgcgggaggacgcgccggcggagcacgtggagaggttcttcgagaaaatggaccggaaccaggatggggtagtgaccattgaagagttcctggaggcctgtcagaaggatgagaacatcatgagctccatgcagctgtttgagaatgtcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dehydrogenase/reductase (SDR family) member 2
- tubulin tyrosine ligase-like family, member 5
- insulin-like growth factor binding protein 5
- family with sequence similarity 44, member A

Buy KCNIP3-Kv channel interacting protein 3, calsenilin Gene now

Add to cart