FAM44A-family with sequence similarity 44, member A Gene View larger

FAM44A-family with sequence similarity 44, member A Gene

PTXBC016987

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM44A-family with sequence similarity 44, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM44A-family with sequence similarity 44, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016987
Product type: DNA & cDNA
Ncbi symbol: FAM44A
Origin species: Human
Product name: FAM44A-family with sequence similarity 44, member A Gene
Size: 2ug
Accessions: BC016987
Gene id: 259282
Gene description: family with sequence similarity 44, member A
Synonyms: FAM44A; BOD1L; biorientation of chromosomes in cell division protein 1-like 1; biorientation of chromosomes in cell division 1-like; family with sequence similarity 44, member A; biorientation of chromosomes in cell division 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaaaagaaaaagaaagcagcattatctctcttcagaagatgaaccagatgataatccagatgtcctggattccagaatagaaacagcacaaaggcagtgtcctgaaacggagccacatgacacaaaggaagagaactccagagatttggaagaattacctaaaaccagttctgagacaaatagcactacctcaagggtcatggaagaaaaagatgaatatagcagcagtgaaactactggtgaaaagccagagcagaacgatgatgacaccataaaatctcaggaggaagatcagccaataattattaaaaggaaaagaggaagacctcgcaaataccctgtagaaacaacgttaaaaatgaaagacgactccaaaacagatactggcattgtcactgtagaacaatctccatctagcagcaaactgaaagtaatgcaaacagatgaatccaataaagaaacagctaacctacaagaaagaagtataagcaatgatgatggtgaagaaaaaatagtaacaagtgtgcgtcggagaggaagaaaacccaaacgttctctcactgtatcagatgatgctgaatcctcagagccagaaagaaaacgccagaaatcagtttctgatccagtggaggacaagaaagagcaggagtctgatgaggaagaggaagaagaggaagaggacgagccttcaggagccaccacaagatccaccaccagatcagaggctcagagatcaaagacacagctctccccttctatcaagcgcaagagagaagtcagccctcctggggcccgaacaagaggccagcaaagggtggaggaagcccctgtgaaaaaagcgaagcgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MU-2/AP1M2 domain containing, death-inducing
- family with sequence similarity 54, member B
- family with sequence similarity 83, member A
- dehydrogenase/reductase (SDR family) member 3

Buy FAM44A-family with sequence similarity 44, member A Gene now

Add to cart