Login to display prices
Login to display prices
DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene View larger

DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene

PTXBC002730

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene

Proteogenix catalog: PTXBC002730
Ncbi symbol: DHRS3
Product name: DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene
Size: 2ug
Accessions: BC002730
Gene id: 9249
Gene description: dehydrogenase/reductase (SDR family) member 3
Synonyms: DD83.1; RDH17; Rsdr1; SDR1; SDR16C1; retSDR1; short-chain dehydrogenase/reductase 3; dehydrogenase/reductase (SDR family) member 3; dehydrogenase/reductase member 3; retinal short-chain dehydrogenase/reductase 1; retinol dehydrogenase 17; short chain dehydrogenase/reductase family 16C member 1; short-chain dehydrogenase/reductase 1; dehydrogenase/reductase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtggaaacggctgggcgcgctggtgatgttccctctacagatgatctatctggtggtgaaagcagccgtcggactggtgctgcccgccaagctgcgggacctgtcgcgggagaacgtcctcatcaccggcggcgggagaggcatcgggcgtcagctcgcccgcgagttcgcggagcgcggcgccagaaagattgttctctggggccggactgagaaatgcctgaaggagacgacggaggagatccggcagatgggcactgagtgccattacttcatctgtgatgtgggcaaccgggaggaggtgtaccagacggccaaggccgtccgggagaaggtgggtgacatcaccatcctggtgaacaatgccgccgtggtccatgggaagagcctaatggacagtgatgatgatgccctcctcaagtcccaacacatcaacaccctgggccagttctggaccaccaaggccttcctgccgcgtatgctggagctgcagaatggccacatcgtgtgcctcaactccgtgctggcactgtctgccatccccggtgccatcgactactgcacatccaaagcgtcagccttcgccttcatggagagcctgaccctggggctgctggactgtccgggagtcagcgccaccacagtgctgcccttccacaccagcaccgagatgttccagggcatgagagtcaggtttcccaacctctttcccccactgaagccggagacggtggcccggaggacagtggaagctgtgcagctcaaccaggccctcctcctcctcccatggacaatgcatgccctcgttatcttgaaaagcatacttccacaggctgcactcgaggagatccacaaattctcaggaacctacacctgcatgaacactttcaaagggcggacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: