Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002730 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHRS3 |
| Origin species: | Human |
| Product name: | DHRS3-dehydrogenase/reductase (SDR family) member 3 Gene |
| Size: | 2ug |
| Accessions: | BC002730 |
| Gene id: | 9249 |
| Gene description: | dehydrogenase/reductase (SDR family) member 3 |
| Synonyms: | DD83.1; RDH17; Rsdr1; SDR1; SDR16C1; retSDR1; short-chain dehydrogenase/reductase 3; dehydrogenase/reductase (SDR family) member 3; dehydrogenase/reductase member 3; retinal short-chain dehydrogenase/reductase 1; retinol dehydrogenase 17; short chain dehydrogenase/reductase family 16C member 1; short-chain dehydrogenase/reductase 1; dehydrogenase/reductase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgtggaaacggctgggcgcgctggtgatgttccctctacagatgatctatctggtggtgaaagcagccgtcggactggtgctgcccgccaagctgcgggacctgtcgcgggagaacgtcctcatcaccggcggcgggagaggcatcgggcgtcagctcgcccgcgagttcgcggagcgcggcgccagaaagattgttctctggggccggactgagaaatgcctgaaggagacgacggaggagatccggcagatgggcactgagtgccattacttcatctgtgatgtgggcaaccgggaggaggtgtaccagacggccaaggccgtccgggagaaggtgggtgacatcaccatcctggtgaacaatgccgccgtggtccatgggaagagcctaatggacagtgatgatgatgccctcctcaagtcccaacacatcaacaccctgggccagttctggaccaccaaggccttcctgccgcgtatgctggagctgcagaatggccacatcgtgtgcctcaactccgtgctggcactgtctgccatccccggtgccatcgactactgcacatccaaagcgtcagccttcgccttcatggagagcctgaccctggggctgctggactgtccgggagtcagcgccaccacagtgctgcccttccacaccagcaccgagatgttccagggcatgagagtcaggtttcccaacctctttcccccactgaagccggagacggtggcccggaggacagtggaagctgtgcagctcaaccaggccctcctcctcctcccatggacaatgcatgccctcgttatcttgaaaagcatacttccacaggctgcactcgaggagatccacaaattctcaggaacctacacctgcatgaacactttcaaagggcggacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - STIP1 homology and U-box containing protein 1 - family with sequence similarity 82, member B - non-SMC element 4 homolog A (S. cerevisiae) - family with sequence similarity 50, member B |