Login to display prices
Login to display prices
STUB1-STIP1 homology and U-box containing protein 1 Gene View larger

STUB1-STIP1 homology and U-box containing protein 1 Gene

PTXBC007545

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STUB1-STIP1 homology and U-box containing protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STUB1-STIP1 homology and U-box containing protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007545
Product type: DNA & cDNA
Ncbi symbol: STUB1
Origin species: Human
Product name: STUB1-STIP1 homology and U-box containing protein 1 Gene
Size: 2ug
Accessions: BC007545
Gene id: 10273
Gene description: STIP1 homology and U-box containing protein 1
Synonyms: HSPABP2; NY-CO-7; SCAR16; SDCCAG7; UBOX1; E3 ubiquitin-protein ligase CHIP; CLL-associated antigen KW-8; STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase; antigen NY-CO-7; carboxy terminus of Hsp70-interacting protein; heat shock protein A binding protein 2 (c-terminal); serologically defined colon cancer antigen 7; STIP1 homology and U-box containing protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagggcaaggaggagaaggagggcggcgcacggctgggcgctggcggcggaagccccgagaagagcccgagcgcgcaggagctcaaggagcagggcaatcgtctgttcgtgggccgaaagtacccggaggcggcggcctgctacggccgcgcgatcacccggaacccgctggtggccgtgtattacaccaaccgggccttgtgctacctgaagatgcagcagcacgagcaggccctggccgactgccggcgcgccctggagctggacgggcagtctgtgaaggcgcacttcttcctggggcagtgccagctggagatggagagctatgatgaggccatcgccaatctgcagcgagcttacagcctggccaaggagcagcggctgaacttcggggacgacatccccagcgctcttcgaatcgcgaagaagaagcgctggaacagcattgaggagcggcgcatccaccaggagagcgagctgcactcctacctctccaggctcattgccgcggagcgtgagagggagctggaagagtgccagcgaaaccacgagggtgatgaggacgacagccacgtccgggcccagcaggcctgcattgaggccaagcacgacaagtacatggcggacatggacgagcttttttctcaggtggatgagaagaggaagaagcgagacatccccgactacctgtgtggcaagatcagctttgagctgatgcgggagccgtgcatcacgcccagtggcatcacctacgaccgcaaggacatcgaggagcacctgcagcgtgtgggtcattttgaccccgtgacccggagccccctgacccaggaacagctcatccccaacttggctatgaaggaggttattgacgcattcatctctgagaatggctgggtggaggactactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 82, member B
- non-SMC element 4 homolog A (S. cerevisiae)
- family with sequence similarity 50, member B
- LIM and senescent cell antigen-like domains 1