FAM82B-family with sequence similarity 82, member B Gene View larger

FAM82B-family with sequence similarity 82, member B Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM82B-family with sequence similarity 82, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM82B-family with sequence similarity 82, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009671
Product type: DNA & cDNA
Ncbi symbol: FAM82B
Origin species: Human
Product name: FAM82B-family with sequence similarity 82, member B Gene
Size: 2ug
Accessions: BC009671
Gene id: 51115
Gene description: family with sequence similarity 82, member B
Synonyms: FAM82B; CGI-90; RMD-1; RMD1; regulator of microtubule dynamics protein 1; family with sequence similarity 82, member B; microtubule-associated protein; regulator of microtubule dynamics 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctggctgctcgactgtggcgccttctgcctttccgacgtggagccgccccggggtctcgtctccctgcggggacttcgggcagccgcgggcattgcggcccctgtcgattccgcggcttcgaggtaatgggaaacccaggaactttcaaaagaggccttttactctcagctttgtcgtatttgggttttgaaacttaccaggttatctctcaggctgctgtggttcatgccacagccaaagttgaagaaatacttgaacaagcagactacctgtatgaaagcggagaaacagaaaaactttatcagttgctaacccaatacaaggaaagtgaagatgcagagttactgtggcgtttggcacgggcatcacgtgatgtagctcagcttagcagaacctcagaagaggagaaaaagctattggtgtatgaagccctagagtatgcaaaaagagcactagaaaaaaatgaatcaagttttgcatctcataagtggtatgcaatctgccttagtgatgttggagattatgaaggcatcaaggctaaaattgcaaatgcatatatcatcaaggagcattttgagaaagcaattgaactgaaccctaaagatgctacttcaattcaccttatgggtatttggtgctatacatttgccgaaatgccttggtatcaaagaagaattgctaaaatgctgtttgcaactcctcctagttccacctatgagaaggccttaggctactttcacagggcagaacaagtggatccaaacttctacagcaaaaacttacttcttttaggaaagacatacttgaaactacacaacaaaaagcttgctgctttctggctaatgaaagccaaggactatccagcacacacagaggaggataaacagatacagacagaagctgctcagttgcttacaagtttcagtgagaagaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-SMC element 4 homolog A (S. cerevisiae)
- family with sequence similarity 50, member B
- LIM and senescent cell antigen-like domains 1
- family with sequence similarity 86, member A

Buy FAM82B-family with sequence similarity 82, member B Gene now

Add to cart