Login to display prices
Login to display prices
FAM86A-family with sequence similarity 86, member A Gene View larger

FAM86A-family with sequence similarity 86, member A Gene

PTXBC010084

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM86A-family with sequence similarity 86, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM86A-family with sequence similarity 86, member A Gene

Proteogenix catalog: PTXBC010084
Ncbi symbol: FAM86A
Product name: FAM86A-family with sequence similarity 86, member A Gene
Size: 2ug
Accessions: BC010084
Gene id: 196483
Gene description: family with sequence similarity 86, member A
Synonyms: protein FAM86A; FAM86A; SB153; eEF2-KMT; protein-lysine N-methyltransferase EEF2KMT; eEF2-lysine methyltransferase; family with sequence similarity 86, member A; eukaryotic elongation factor 2 lysine methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccgaggagaacgcggggaccgaactcttgctgcagagtttcgagcgccgcttcctggcggcacgcacactgcgctccttcccctggcagagcttagaagcaaagttaagagactcatcagattctgagctgctgcgggatattttgcacaagactgtgaagcatcctgtgtgtgtgaagcacccgccgtccgtcaaatatgcccggtgctttctctcagaactcatcaaaaagcacgaggctgtccacacagagcctttggacgagctgtatgaagcgctggcggagaccctgatggccaaggagtccacccagggccaccggagctatttgctgccctcgggaggctcggtcacactctccgagagcacggccatcatctcctacggtaccacaggcctggtcacatgggacgccgccctctaccttgcagaatgggccatcgagaacccggcagtcttcactaacaggactgtcctagagcttggcagtggtgctggcctcacaggcctggccatctgcaagatgtgccgcccccgggcatacatcttcagcgactgtcacagccgggtccttgagcagctccgagggaatgtccttctcaatggcctctcattagaggcagacatcactgccaagttagacagccccagggtgacagtggcccagctggactgggacgtcgcgacggtccatcagctctctgccttccagccagatgttgtcattgcagcagatgtgctgtattgcccagaagccatcatgtcgctggtcggcgtcctgcggaggctggctgcctgccgggaggaccagcgggctcctgaggtctacgtggcctttaccgtccgcaacccagagacgtgccagctgttcaccaccgagctaggccgggccgggatcagatgggaagtggaacctcgtcatgagcagaaactgtttccctacgaagagcacttggagatggcaatgctgaatctcaccctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: