FAM83F-family with sequence similarity 83, member F Gene View larger

FAM83F-family with sequence similarity 83, member F Gene

PTXBC011204

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM83F-family with sequence similarity 83, member F Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM83F-family with sequence similarity 83, member F Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011204
Product type: DNA & cDNA
Ncbi symbol: FAM83F
Origin species: Human
Product name: FAM83F-family with sequence similarity 83, member F Gene
Size: 2ug
Accessions: BC011204
Gene id: 113828
Gene description: family with sequence similarity 83, member F
Synonyms: protein FAM83F; family with sequence similarity 83 member F
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctcttcactgatggtgatatctttcaagacattgtggatgctgcctgtaagcgccgggtcccagtgtacatcatcctggacgaggcaggagtgaagtatttcctggagatgtgtcaggacctgcagctcactgacttccggattcggaacatccgtgtccgctctgtgacaggcgtcggcttctacatgcccatggggaggatcaaggggaccctgtcatcaaggttcctgatggtggacggtgacaaagtggccactggatcttacaggttcacctggagttcctcccatgtggacagaaacctcctcctgctcctgacaggacagaacgtagagccctttgacacggagttccgggagctgtacgccatctccgaggaggtggacttgtaccggcagctgagcctggcgggcagggttggcctccattactcctccactgtggctcgaaagcttatcaaccccaagtacgccttggtgtcaggctgccgccacccgcctggggagatgatgcgctgggctgcccggcaacagtgggaggcgggcggcaacccggaggggcaggaggagggcgccagcggtggcgagtcggcctggcgcctggagagcttcctgaaagacctggttacggtggagcaggtgctgccccccgtggagcccatccccttgggagagctgagccagaaggatggcaggatggtctctcacatgcacagagacctgaagcccaaatcccgagaggcacccagccgaaacggcatgggagaagcggcccggggggaggccgcccccgccaggcgcttcagcagcaggctcttcagtcgccgagccaagaggcctgcggcgcccaatggcatggccagctctgtctccaccgagacctctgaagtggagtttctgacggggaagaggcccaacgagaattccagtgctgacatctcaggtaaaacaagtcccagttctgccaagcctagcaactgtgtgatttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin, gamma complex associated protein 4
- glycerol-3-phosphate dehydrogenase 1 (soluble)
- TFIIS central domain-containing protein 1
- family with sequence similarity 29, member A

Buy FAM83F-family with sequence similarity 83, member F Gene now

Add to cart