FAM29A-family with sequence similarity 29, member A Gene View larger

FAM29A-family with sequence similarity 29, member A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM29A-family with sequence similarity 29, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM29A-family with sequence similarity 29, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010632
Product type: DNA & cDNA
Ncbi symbol: FAM29A
Origin species: Human
Product name: FAM29A-family with sequence similarity 29, member A Gene
Size: 2ug
Accessions: BC010632
Gene id: 54801
Gene description: family with sequence similarity 29, member A
Synonyms: FAM29A; Dgt6; HAUS augmin-like complex subunit 6; dim gamma-tubulin homolog; family with sequence similarity 29, member A; HAUS augmin like complex subunit 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaaaacagaactaaagaaccaattcaaatggatgttgaacatagagaagtattgccagaatcattacctgtgttgcacaatcaaagagaatttagcatggctgattttctcttagaaaccactgtatcagattttggccagtctcatttgactgaagagaaagttatttcagattgcgagtgtgtgcctcagaaacatgtgctgaccagtcacatagatgaaccaccaacacaaaatcagtcagatttgttaaataagaaagtaatttgcaagcaagatttggaatgtttagccttcaccaagctttcagaaactagccgaatggagacattctcccctgctgtcggcaataggatagatgtgatgggtggcagtgaagaggagtttatgaaaatattggaccacttagaagtttcttgtaacaaaccttccacaaataaaactatgttgtggaattcttttcagatatcaattggaattagttctaagagttttaaagataatgattttggcatattacacgaaactctcccggaagaagttggtcatctaagttttaatagttccagtagttcagaggccaattttaaactggagccaaatagtcctatgcatggtggcactcttctagaagatgttgtgggagggagacagactactccagaatcagactttaatttacaggctcttcgcagtagatacgaggctctgaagaaatctctttccaagaaaagggaagaatcttacctctcgaattcccaaacacccgaaagacacaaaccagaattgagccctactccccaaaatgtacaaacagatgatacgcttaactttttggacacctgtgatttgcatactgagcatataaagccatctttacgcacgtccatcggtgaaagaaaacggtctctttcaccactaattaagttttctccagtggaacaaagattgagaaccacaatagcatgtagtcttggagaactacctaatttaaaggaagaagacattttgaataagagccttgatgcaaaagaaccaccgtctgacttgacaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 38, member A
- platelet-derived growth factor receptor-like
- purinergic receptor P2Y, G-protein coupled, 2
- family with sequence similarity 46, member D

Buy FAM29A-family with sequence similarity 29, member A Gene now

Add to cart