FAM46D-family with sequence similarity 46, member D Gene View larger

FAM46D-family with sequence similarity 46, member D Gene

PTXBC028710

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM46D-family with sequence similarity 46, member D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM46D-family with sequence similarity 46, member D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028710
Product type: DNA & cDNA
Ncbi symbol: FAM46D
Origin species: Human
Product name: FAM46D-family with sequence similarity 46, member D Gene
Size: 2ug
Accessions: BC028710
Gene id: 169966
Gene description: family with sequence similarity 46, member D
Synonyms: protein FAM46D; CT1.26; CT112; cancer/testis antigen 112; family with sequence similarity 46 member D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaaatcagattcaccaatctcgcttgggatcaagttataacactggatcaagtgttagatgaagtaattccaattcatggaaaggggaatttccccacaatggaggtaaaaccaaaagacatcattcatgttgtgaaagatcaactcatagggcaaggaattattgttaaagatgccagattgaatggttccgtagcaagttacatacttgcaagccacaatggaatcagctataaggatctggacgttatttttggtgttgagcttccaggtaacgaagaatttcaggttgttaaagatgcagttctagactgtctacttgactttttaccaaaagatgtaaagaaggaaaagctctccccagatatcatgaaagacgcttacgtacagaaattggtcaaggtttgcaatgggcatgattgttggagtcttatctccctttcaaataacactgggaagaatttagaactaaaatttgtgagttcactcagacggcagtttgaatttagtgtagattcctttcaaattgttttggatcccatgttagacttctacagtgacaaaaatgccaagctaaccaaagaatcctatcctgttgtggtagctgaaagcatgtatggagacttccaggaagcaatgacacatttgcaacacaagctcatatgtaccaggaaacctgaagagattagaggtggtggccttctgaagtactgcagcttgctggttcatggcttcaagccagcctgtatgtcagaaatcaaaaacctagaacgttatatgtgctctagattctttattgattttcctcatatagaagaacagcaaaagaaaattgaatcatacctccacaaccatttcataggtgaaggaatgaccaagtatgactaccttatgaccttgcatggagttgtgaatgaaagcactgtttgcctcatgagttatgaaagaagacagattctccacctgatcaccatgatggctttgaaagtacttggagaactaaatattctacccaatacacaaaaggtaacttgcttttatcagcctgctccgtactttgcagctgaggcaaggtaccctatttatgtaatacctgagccaccccccgttagcttccagccataccacccactgcaccttcgtggatcaaatggtatgagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - minichromosome maintenance complex component 9
- poly(A) binding protein interacting protein 1
- phosphoinositide-3-kinase adaptor protein 1
- family with sequence similarity 55, member A

Buy FAM46D-family with sequence similarity 46, member D Gene now

Add to cart