MCM9-minichromosome maintenance complex component 9 Gene View larger

MCM9-minichromosome maintenance complex component 9 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCM9-minichromosome maintenance complex component 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MCM9-minichromosome maintenance complex component 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031658
Product type: DNA & cDNA
Ncbi symbol: MCM9
Origin species: Human
Product name: MCM9-minichromosome maintenance complex component 9 Gene
Size: 2ug
Accessions: BC031658
Gene id: 254394
Gene description: minichromosome maintenance complex component 9
Synonyms: DNA replication licensing factor MCM9; DNA helicase MCM9; C6orf61; MCMDC1; ODG4; dJ329L24.1; dJ329L24.3; mini-chromosome maintenance deficient domain-containing protein 1; minichromosome maintenance complex component 9; minichromosome maintenance 9 homologous recombination repair factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatagcgatcaagttacactggttggtcaagtgtttgagtcatatgtttcggaataccataagaatgatattcttctaatcttgaaggaaagggatgaagatgctcattacccagttgtggttaatgccatgactctgtttgagaccaacatggaaatcggggaatatttcaacatgttccccagtgaagtgcttacaatttttgatagtgcactgcgaaggtcagccttgacaattctccagtccctttctcagcctgaggctgtttccatgaaacagaatcttcatgccaggatatcaggtttgcctgtctgtcctgagctggtgagggaacacatacctaaaaccaaggatgtgggacactttttatctgtcactgggacagtgattcgaacaagtctggtgaaggttctggagtttgagcgggattacatgtgtaacaaatgcaagcatgtgtttgtgatcaaggctgactttgagcagtattacaccttttgccggccatcctcgtgtcccagcttggagagctgtgattcctctaaattcacttgcctctcaggcttgtcttcatctccaaccaggtgtagagattaccaggaaatcaaaattcaggaacaggttcaaaggctatctgttggaagtattccacgatctatgaaggttattctggaagatgacttagtggatagttgcaaatctggtgatgacctcactatttacgggattgtaatgcaacggtggaagccctttcagcaagatgtgcgctgtgaagtggagatagtcctgaaagcaaattacatccaagtaaataatgagcagtcctcagggatcatcatggatgaggaggtccaaaaggaattcgaagatttttgggaatactataagagcgatccctttgcaggaaggaatgtaatattggctagcttgtgccctcaagtgtttggaatgtatctagtaaagcttgctgtggccatggtgctggctggtgggattcaaaggactgatgctacaggaacacgggtcagaggagaatctcatcttttattggttggggatcctggcacagggaaatctcagttcctcaaatatgcagcaaagattacaccaagatctgtgctgaccacaggaattggatctactagtgcaggtattgtatgtgacaatttcaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly(A) binding protein interacting protein 1
- phosphoinositide-3-kinase adaptor protein 1
- family with sequence similarity 55, member A
- family with sequence similarity 81, member B

Buy MCM9-minichromosome maintenance complex component 9 Gene now

Add to cart