Login to display prices
Login to display prices
PIK3AP1-phosphoinositide-3-kinase adaptor protein 1 Gene View larger

PIK3AP1-phosphoinositide-3-kinase adaptor protein 1 Gene

PTXBC029917

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIK3AP1-phosphoinositide-3-kinase adaptor protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIK3AP1-phosphoinositide-3-kinase adaptor protein 1 Gene

Proteogenix catalog: PTXBC029917
Ncbi symbol: PIK3AP1
Product name: PIK3AP1-phosphoinositide-3-kinase adaptor protein 1 Gene
Size: 2ug
Accessions: BC029917
Gene id: 118788
Gene description: phosphoinositide-3-kinase adaptor protein 1
Synonyms: BCAP; phosphoinositide 3-kinase adapter protein 1; B cell adaptor protein; B-cell adapter for phosphoinositide 3-kinase; B-cell phosphoinositide 3-kinase adapter protein 1; phosphoinositide-3-kinase adaptor protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtttttcaccagcgtggcctgctatggatcttgtctctttgcatctgagttgctgatcagatgcaaggactggctcaaaggaagaccagctctcttcactgccctgctagcttgtgtcctttatctttgtgagtggactggtgccaagcatgtcccagggtcatcttatgttgaaatgcttcaggccagtacatctaacccaatccctggagatggtttctctcgggccactaaggactctatgatccgcaagtttttagaaggcaacagcatgggaatgaccaatctggagagagatcagtgccatcttggtcaggaagaagatgtttatcacacggtggatgacgatgaggccttttctgtggacttggccagcaggccccctgtcccagtgcccagaccagagaccactgctcctggtgctcaccagctgcctgacaacgaaccatacatttttaaagtttttgcagaaaaaagtcaagagcggcctgggaatttctacgtttcctcagagagcatcaggaaagggccgcccgtcagaccatggagggacaggccccagtcgagtatatatgacccttttgcgggaatgaaaacgccaggccagcggcagcttatcaccctccaggagcaggtgaagctgggcattgtcaacgtggatgaggctgtgctccacttcaaagagtggcagctcaaccagaagaaacgatcggagtcctttcgtttccagcaggaaaatcttaaacggctaagagacagcatcacccgaagacagagagagaagcaaaaatcaggaaagcagacagacttggagatcacggtcccaattcggcactcacagcacctgcctgcaaaagtggagtttggagtctatgagagtggccccaggaaaagcgtcattccccctaggacggagctgagacgaggagactggaaaacagacagcacctccagcacagcaagtagcacaagtaaccgctccagcacccggagcctcctcagtgtgagcagcgggatggaaggggacaacgaggataatgaagtccctgaggttaccagaagtcgcagtccaggccccccacaagtggatgggacacccaccatgtccctcgagagaccccccagggtgcctccgagagctgcctcacagaggcctccgaccagggagaccttccatcctcctccacctgttccacccagaggacgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: